Brazil
Anais da Academia Brasileira de Ciências
Table of contents previous current next
Table of contents
CELLULAR AND MOLECULAR BIOLOGY • An. Acad. Bras. Ciênc. 98 (3) • 2026 • https://doi.org/10.1590/0001-3765202620260024 linkcopy

Open-access A New Species of Luteoporia (Meruliaceae, Basidiomycota) from an Urban Forest in the Brazilian Amazon

    • SCIMAGO INSTITUTIONS RANKINGS

Abstract

Luteoporia camposii is described based on integrative morphological and molecular evidence from material collected in an urban park in the Brazilian Amazon. The species is characterized by annual, resupinate basidiomes; vivid yellow pores when fresh, becoming brown to dark brown upon drying; tissues turn purple in KOH; a monomitic hyphal system with thick-walled generative hyphae bearing clamp connections; and subcylindrical basidiospores (3.4–5.0 × 1.6–2.3 μm). Phylogenetic analyses based on combined ITS and nrLSU rDNA sequences recovered L. camposii as a strongly supported monophyletic lineage sister to L. albocitrina, with L. albomarginata resolved as the basal lineage to this clade. Morphological characteristics and molecular phylogeny consistently support L. camposii as a distinct species. A full description, illustrations, phylogenetic analyses, comparisons with related species, and an identification key to the currently known species of Luteoporia are provided.

Key words
Amazon rainforest; Phlebioid-clade; Phylogeny; Taxonomy; Wood-decaying fungi

INTRODUCTION

Luteoporia F. Wu, Jia J. Chen & S.H. He is a genus in the family Meruliaceae, typified by L. albomarginata F. Wu, Jia J. Chen & S.H. He (Wu et al. 2016, Liu et al. 2022). Species of the genus are characterized by resupinate basidiome with poroid or odontioid hymenophores, tissues turning pink, reddish or purple in potassium hydroxide (KOH), a monomitic hyphal system with clamped generative hyphae, the presence of fine yellow crystals, and hyaline, thin-walled basidiospores (Wu et al. 2016). Phylogenetic studies have consistently recovered Luteoporia as a well-supported monophyletic clade within Meruliaceae (Chen et al. 2021, Li et al. 2025).

Currently, the genus comprises six described species (Wu et al. 2016, Liu & Yuan 2020, Chen et al. 2021, Zhao et al. 2023, Luo et al. 2024, Zhang et al. 2024, Zhou et al. 2024), with records concentrated mainly in Asia, Oceania and Europe (Zhang et al. 2024, Zhao et al. 2026). In contrast, occurrences in the Neotropical region remain scarce, highlighting a significant biogeographical gap in our knowledge of the genus (GBIF 2025).

Although the Amazon is globally recognized as one of the major biodiversity hotspots, fungal diversity remains markedly underexplored, particularly in urban environments (Raven et al. 2020, Guayasamin et al. 2024). Over the past four decades, the region has undergone extensive land-use changes driven by cattle ranching, agriculture, mining, urban expansion and large-scale logging (Lapola et al. 2023). In this context, urban forest fragments act as important refugia for biodiversity within highly modified landscapes, providing ecological, social and cultural benefits, as well as essential ecosystem services such as carbon storage and climate regulation (Silva et al. 2019, Aguiar et al. 2023).

In this study, we describe a new species of Luteoporia based on morphological and molecular evidence from material collected in an urban forest fragment in the metropolitan region of Belém, Brazilian Amazon. We provide detailed macro- and micromorphological descriptions, as well as an identification key to the species of Luteoporia.

MATERIALS AND METHODS

Study area

The specimen was collected in the Parque Estadual do Utinga Camillo Vianna (PEUt), a fully protected conservation unit (1°25’30.0” S, 48°26’36.5” W) (Figure 1) located in the metropolitan region of Belém, state of Pará. The park covers an area of 1,393.088 hectares, and its predominant vegetation includes dense lowland rainforest, upland (“terra firme”), flooded igapó forests, as well as secondary forests (SEMAS 2013, Brasil-Neto et al. 2021, Ferreira et al. 2022).

thumbnail of Figure 1
Figure 1
Study area: Parque Estadual do Utinga Camillo Vianna (PEUt). Trails explored for collections are highlighted.

Morphological identification

The sample was dried at 40 °C using a food dehydrator and subsequently deposited in the João Murça Pires Herbarium at the Museu Paraense Emílio Goeldi (MPEG). Macroscopic features were described from field notes and dried specimens. Colors were determined following Kornerup & Wanscher (1978). Microscopic analyses were performed on free-hand sections mounted in 3% potassium hydroxide (KOH) with 1% aqueous phloxine. Amyloid and dextrinoid reactions were tested using Melzer’s reagent (IKI), and cotton blue (CB) was used to assess cyanophily (Ryvarden 1991). The hyphal system was characterized according to Teixeira (1995).

Microscopic structures, including basidia, basidiospores, hyphae and cystidia, were examined and photographed at magnifications up to 1000× using a light microscope (Leica DM6 B, Leica Microsystems CMS GmbH, Wetzlar, Germany). The following abbreviations are used: CB+ = cyanophilous; CB– = acyanophilous; IKI– = neither amyloid nor dextrinoid; L = mean spore length (mean of all spores measured); W = mean spore width (mean of all spores measured); Q = range of L/W ratios; n(a/b) = number of spores measured (a) from number of specimens examined (b). A minimum of 30 basidiospores were measured per specimen.

Molecular phylogeny and phylogenetic analyses

Genomic DNA (gDNA) was extracted from dried material stored in silica gel. Liquid nitrogen was employed to disrupt the hyphal walls, followed by DNA extraction using the DNeasy® Plant Pro Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. Polymerase chain reaction (PCR) was performed to amplify the following regions of interest: internal transcribed spacer (ITS) and large subunit rRNA (LSU). For ITS, the primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) were used, while the primers LR0R (ACCCGCTGAACTTAAGC) and LR07 (TACTACCACCAAGATCT) were utilized for LSU (White et al. 1990, Moncalvo et al. 2000). Each PCR had a final volume of 12.5 µL containing 1 µL of DNA, 4.25 µL of nuclease-free water, 0.5 µL of each primer and 6.25 µL of Promega Master Mix. PCR was conducted for both genes using the following cycling conditions: 94 °C for 3 min, 35 cycles of 94° for 1 min, 50 °C for 1 min, 72 °C for 2 min, with a final extension at 72 °C for 10 min. The PCR products were purified using ExoSAP-IT™ PCR Product Cleanup Reagent (Thermo Fisher Scientific, USA) and sequenced with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, USA) in an automatic genetic analyzer (ABI 3130, Thermo Fisher Scientific, MA, USA).

Sequence alignment and phylogenetic analyses

Electropherograms of the ITS and nrLSU sequences were examined and edited using BioEdit v.7.0 (Hall 1999). Taxon sampling for the Meruliaceae dataset, including outgroups, followed the phylogenetic topologies proposed by Li et al. (2025). Two species, Phlebiopsis gigantea (Fr.) Jülich and Rhizochaete radicata (Henn.) Gresl., Nakasone & Rajchenb., were selected as outgroups. Additional sequences were obtained via BLAST searches against the National Center for Biotechnology Information (NCBI) database (Table I). Each marker (ITS and nrLSU) was aligned separately with MAFFT v.7 using the “Auto” strategy (Katoh & Standley 2013). Alignments were inspected and manually adjusted in MEGA v.11 (Tamura et al. 2021), and ambiguously aligned regions were identified and excluded with Gblocks online (Lemoine et al. 2019). The ITS and nrLSU datasets were then concatenated in Mesquite v.3.81 (Maddison & Maddison 2023), resulting in a combined matrix that included 80 specimens.

Thumbnail
Table I
Names, specimen numbers and corresponding GenBank accession numbers of the taxa used in this study. The new sequences are in bold.

Maximum likelihood (ML) and Bayesian inference (BI) analyses were performed using RAxML-HPC v8.0.2 (Stamatakis 2014) and MrBayes v3.2.6 (Ronquist et al. 2012), respectively, via the CIPRES Science Gateway (www.phylo.org) (Miller et al. 2010). For the ML analysis, branch support was estimated using 1,000 bootstrap replicates.

MrModeltest 2.3 (Nylander 2004) was used to select the best-fit substitution model under the Akaike information criterion (AIC) after evaluating 24 evolutionary models in PAUP* v4.0 (Swofford 2002) for each dataset in the BI analysis. Four Markov chains were run for 10,000,000 generations, sampling every 1,000 generations, until the average standard deviation of split frequencies fell below 0.01. After the run, the first 10% of the trees were discarded as burn-in, and the remaining trees were combined to reconstruct a majority rule consensus tree and calculate Bayesian posterior probabilities (BPP). The resulting phylogenetic tree was visualized using iTOL v6 (Letunic & Bork 2024) and edited using Adobe Illustrator CS5 (Adobe Systems Inc.).

RESULTS

Molecular analyses

The combined ITS + nLSU dataset included sequences from 82 specimens representing 83 species (Table I). The dataset had an aligned length of 1,557 nucleotide sites, of which 788 were constant, 134 were variable but parsimony uninformative, and 635 were parsimony informative. The best model for the ITS + nLSU dataset estimated and applied in the Bayesian analysis was GTR+I+G. Bayesian analysis analysis resulted in a similar topology to the ML analysis, with an average standard deviation of split frequencies of 0.008615 (BI).

The phylogenetic tree topologies obtained through the ML and BI analyses were generally congruent in highly supported clades, and the maximum likelihood phylogram is shown here (Fig. 2). The new species Luteoporia camposii formed a strongly supported monophyletic clade, with L. albocitrina (Petch) Y.C. Dai, Xin Zhang bis, Vlasák, Ghob.-Nejh. & Yuan Yuan as its sister (BS 100%, BPP 1.00), whereas L. albomarginata was resolved as the basal lineage to the L. camposii–L. albocitrina clade (BS 77%, BPP 0.72).

thumbnail of Figure 2
Figure 2
Phylogenetic relationships of Luteoporia camposii (in bold) and related species within Meruliaceae family, inferred from combined ITS and nrLSU rDNA sequence data. Branch support values are indicated as maximum likelihood bootstrap percentages (≥ 50) and Bayesian posterior probabilities (≥ 0.95), respectively. ★ indicates type species ● indicates generic type.

Taxonomy

Luteoporia camposii Braz-Silva, Gondim-Vieira & A.M.S Soares, sp. nov. (Fig. 3)

thumbnail of Figure 3
Figure 3
a–c: Basidiome of Luteoporia camposii (holotype, DS191). d-e: Basidiome of Luteoporia camposii (INPA 185840). a-b: Fresh basidiome; c: Tubes. d-e: Pores. Scale bars: a = 5 cm; b = 1 cm; c = 0.5 cm; d = 0.2 cm; e = 0.1 mm.

Figure 4

thumbnail of Figure 4
Figure 4
a-i: Microscopic structures of Luteoporia camposii (holotype, DS191). a: Hyphae from dissepiments. b: Generative hyphae from the subiculum. c: Generative hyphae from the trama. d-e: Inflated capitate hyphae from the subiculum. f: Fusoid cystidioles. g: Capitulate cystidiol. h: Basidia. i: Basidiospores. Scale bars: a-i = 10 µm.

MycoBank no.— 861949

Etymology

The epithet honors Ezequias Campos, an Amazonian mycologist who dedicated his career to the study of macrofungi, and passed away prematurely.

Type

Brazil, Pará, Belém: Parque Estadual do Utinga Camilo Viana, Castanheira Trail, 24 Aug 2022, D.K. Braz-Silva, DS 191 (MG 249979).

Description

Basidiome annual, resupinate, sometimes merging into stalactite-like or nodulose formations; watery soft when fresh and coriaceous when dry; up to 15 cm long, 6 cm wide and approximately 3 mm thick at the center. Pore surface vivid yellow (2B8) when fresh, becomes brown (7E8) and dark brown (7F8) when dry; tissue becomes purple in KOH; sterile portions with narrow, irregular and lobed margin, cream (1A2) to pale yellow (1A3), with whitish patches, especially on young or sterile portions, thinning out, 0.2 mm; pores angular to irregulars, 3–6 per mm, sometimes 1–2 per mm; dissepiments very thin, lacerate; subiculum very thin to almost absent, up to 0.2 mm thick; tubes concolorous with pore surface, elongated, up to 4.11 mm long. Hyphal system monomitic; generative hyphae simple-septate and bearing clamp connections, IKI–, slightly CB+. Subiculum composed of hyaline generative hyphae, thin- to thick-walled, rarely branched, with scarce encrustations near the hyphal tips; hyphae interwoven, 1.9–5.2 μm in diam. Presence of inflated capitate hyphae, 6.8–12.5 μm in diam. Trama of the tubes composed of hyaline generative hyphae, thin- to thick-walled, simple-septate and with clamp connections, rarely branched; hyphae subparallel along the tubes, 2.5–4.5 μm in diam. Hyphae frequently with swollen apices, especially near dissepiment edges, the swollen tips measuring 3–5 μm in diam. Cystidia absent; however, cystidioles present in two types: (1) fusoid, thin-walled, 5.4–13.7 × 2.5–4.5 μm, and (2) capitulate, thin-walled, 12.5–16.0 × 2.5–3.5 μm. Basidia clavate, hyaline, thin-walled, 4-sterigmate, measuring 11.9–15.5 × 4.5–6.2 μm. Basidioles similar in shape to basidia, but shorter. Basidiospores subcylindrical, hyaline, thin-walled, smooth, occasionally with one or two guttules, IKI–, CB–, (3.1–)3.2–4.8(–5.1) × (1.1–)1.6–2.3(–2.7) μm, L = 3.74 μm, W = 1.73 μm, Q = 2.13 (n=54/2).

Additional material examined:—BRAZIL. Amazonas: Presidente Figueiredo, Usina Hidrelétrica de Balbina, on decaying wood of Schefflera morototoni, 27 Aug 1984, Cardias, F. 541 (INPA 185840).

Distribution and ecology

Costa Rica and Brazil; growing on decaying hardwood.

Notes

Luteoporiacamposii is morphologically similar to L. tenuissima K.Y. Luo, Yuan Yuan, Y.C. Dai & Ghob.-Nejh. in the shape and size of the pores (angular to irregular, mostly 3–4 per mm). However, L. tenuissima differs in having smaller, ellipsoid basidiospores (2.9–3.0 × 1.9–2.4 μm) and in lacking cystidioles (Luo et al. 2024). During a revision of the INPA herbarium, the specimen examined, previously identified as Luteoporia albocitrina [≡ Hapalopilus albocitrinus (Petch) Ryvarden] (INPA 185840), exhibited characters consistent with L. camposii, including a brown coloration when dry, a purplish reaction of the tubes in KOH, the presence of fusoid, thin-walled cystidioles (8.2–12.15 × 3.8–4.1 μm), inflated capitate hyphae, generative hyphae with sparse encrustations, and subcylindrical basidiospores (3.08–4.56 × 1.17–1.45 μm).

DISCUSSION

Luteoporiacamposii formed an independent sister lineage to L. albocitrina with strong statistical support (BS = 100, BPP = 1.00). Morphologically, L. camposii and L. albocitrina exhibit basidiospores of similar shape (subcylindrical), with largely overlapping size ranges (3.5–5.0 × 1.6–2.3 μm). However, several macroscopic, microscopic and chemical characters clearly distinguish both taxa. Luteoporia albocitrina is resupinate, effused and adnate, and is easily recognized by its yellow basidiome, with a white fimbriate margin when fresh, becoming buff, clay pink or pale reddish orange upon drying. In contrast, L. camposii is resupinate but frequently develops stalactite-like or nodulose formations, and its yellow pore surface darkens to brown or dark brown when dry.

In addition, the tissues of L. camposii turn purple in KOH, whereas L. albocitrina shows a strong and diagnostic cherry-red reaction in KOH (Ryvarden 2015). The latter species also presents distinctly swollen hyphae with abundant crystalline encrustations at the hyphal apices and occasional rosette-like crystals (Ryvarden & Johansen 1980, Liu & Yuan 2020), whereas hyphal encrustations are rare in L. camposii.

Luteoporiaalbocitrina was originally described from Sri Lanka as Poria albocitrina [= Hapalopilus albocitrinus (Petch) Ryvarden] by Petch (1922). More recently, L. citriniporia was described from the same region by Liu & Yuan (2020). Based on morphological similarity and overlapping geographic distribution, Zhang et al. (2024) treated L. citriniporia as a synonym of L. albocitrina. In their phylogenetic analyses, the Costa Rican specimen (JV1704_103), identified as L. albocitrina, clustered with the Sri Lanka material, leading the authors to interpret them as a single species, despite the presence of a notably long branch associated with the Costa Rican sequence and the low statistical support of this grouping.

Our phylogenetic analyses recovered the Costa Rican specimen clustered with the Amazonian collection (DS191), forming a distinct and well-supported lineage clearly separated from the Sri Lankan clade (BS = 100%, BPP = 1.00). The consistent topological separation, combined with distinct morphological characters, indicates that the Costa Rican–Amazonian lineage represents a species that is different from the Sri Lankan material. Even though it is morphologically plausible that L. citriniporia represents L. albocitrina, as suggested by Zhang et al. (2024), our results indicate that the Costa Rican specimen does not represent L. albocitrina sensu stricto. Instead, it belongs to the same lineage as the Amazonian material, herein described as Luteoporia camposii. The examined specimen from the INPA herbarium (INPA 185840), collected in 1984 and originally identified as Hapalopilus albocitrinus, shows overall morphological agreement with Luteoporia camposii. Minor differences observed in the historical material, such as a predominance of angular pores without nodulose areas and the absence of capitulate cystidioles, are interpreted as intraspecific variation. Nevertheless, molecular data from additional Neotropical collections is essential to further assess morphological variation and clarify species limits within the genus.

Luteoporia albomarginata occupies a basal position in relation to the clade comprising the new species. Although the basidiospores are similar in size, L. albomarginata differs in having oblong-ellipsoid basidiospores (3.9–5.0 × 1.8–2.2 μm), whereas the new species has subcylindrical basidiospores. Moreover, Luteoporia albomarginata has a soft basidiome when fresh, becoming corky to hard corky when dry, with a tomentose to rhizomorphic, white margin (Wu et al. 2016), whereas L. camposii has a watery soft basidiome when fresh and becomes coriaceous upon drying, presenting an irregular and lobed margin that is cream to pale yellow.

Morphologically, Luteoporia tenuissima. resembles L. camposii in having annual, resupinate basidiomes that are lemon-chrome when fresh, angular to irregular pores (see notes (Luo et al. 2024). Fine yellow crystalline encrustations are frequently observed in L. tenuissima, whereas they are rarely observed in L. camposii. Furthermore, Luteoporia tenuissima lacks cystidia and cystidioles, whereas L. camposii possesses two types of cystidia and cystidioles.

Ceriporiacitrina M. Mata & Ryvarden is another Costa Rican species that could be confused with L. camposii due to its citrine-yellow basidiome when fresh and its oblong-ellipsoid to subcylindrical basidiospores. However, C. citrina differs by having considerably larger basidiospores (7–8 × 3.2–3.5 μm) than those of L. camposii (3.4–5.0 × 1.6–2.3 μm) (Mata & Ryvarden 2010).

Luteoporia belongs to the phlebioid clade, which includes several well-established genera, while others remain poorly known (Justo et al. 2017). The recognition of L. camposii highlights the importance of integrative taxonomic approaches in uncovering hidden diversity within Luteoporia. Such approaches demonstrate that morphologically similar taxa from different biogeographic regions may represent distinct evolutionary lineages and contribute to a more accurate understanding of species boundaries and evolutionary relationships within the genus.

Notably, Luteoporia camposii was collected in an urban forest fragment, representing the first newly described fungal species documented from this locality. This finding underscores the role of urban forest remnants as important refugia for native fungal diversity and highlights their relevance for taxonomic and biogeographic studies (Egerer & Buchholz 2021, Niskanen et al. 2023). In general, urban protected areas are not fully exempt from anthropogenic impacts; taxonomic surveys in such environments are therefore fundamental for documenting species occurrences, improving regional biodiversity knowledge, and for supporting conservation strategies.

Key to species of Luteoporia

  • 1. Hymenophore poroid 2

  • 1’. Hymenophore odontioid 5

  • 2. Basidiome with a white margin, fimbriate to rhizomorphic; pores mostly round to angular 3

  • 2’. Basidiome with a cream to yellow margin, narrow, irregular to lobed, pores mostly irregular, often elongated in nodulose areas 4

  • 3. Tissues become red in KOH; margin snow white when fresh, fimbriate; rosette-like crystals present on hyphae Luteoporia albocitrina

  • 3’. Tissues become purple or unchanged in KOH; margin white when fresh, cottony to rhizomorphic; rosette-like crystals absent on hyphae L. albomarginata

  • 4. Basidiospores ellipsoid, 2.9–3.8 × 1.9–2.4 μm; cystidioles absent L. tenuissima

  • 4’. Basidiospores subcylindrical, 3.4–5.0 × 1.6–2.3 μm; cystidioles of two types: fusoid and capitulate L. camposii

  • 5. Generative hyphae with clamp connections; cystidia absent; fusoid cystidioles present L. lutea (G. Cunn.) C.C. Chen & Sheng H. Wu

  • 5’. Generative hyphae without clamp connections; cystidia present; fusoid cystidioles absent 6

  • 6. Basidiome straw-colored when fresh, becoming pale orange upon drying; tissues are reddish in KOH L. straminea C.L. Zhao

  • 6’. Basidiome lemon-chrome when fresh, becoming curry yellow upon drying; tissues are purple in KOH ..... L. flavula C.L. Zhao & H.M. Zhou

Acknowledgements

The authors thank the Fundação Amazônia de Amparo a Estudos e Pesquisas do Pará (FAPESPA) for the research scholarship granted to Dheanny Braz (Process No. 2749.271222.0016) and the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) for the research scholarship for Antonio Walison Gondim Vieira (Process No. 23084.016926/2025-04). The authors also thank the Universidade Federal Rural da Amazônia (UFRA), the Museu Paraense Emílio Goeldi (MPEG), and the Instituto Nacional de Pesquisas da Amazônia (INPA) for providing technical support and infrastructure during the development of this study. The Laboratório de Biologia Molecular (LBM) is funded by the project “Parque Analítico do MPEG: análise das transformações da Amazônia e seus reflexos na sociobiodiversidade e na paisagem” (FINEP No. 118003100). The Instituto de Desenvolvimento Florestal e da Biodiversidade do Estado do Pará (IDEFLOR-Bio) is acknowledged for logistical support and for granting collection permits (Process No. 2022/456088).

Data availability

Vouchers are deposited in Herbaria MG and INPA. All data generated or analyzed during this study are included in this published article. Sequence data generated for the present study have been deposited in GenBank. Access to genetic resources was registered in the Sistema Nacional de Gestão do Patrimônio Genético e do Conhecimento Tradicional Associado (AA7184F).

References

  • AGUIAR JT, BRUN FGK, HIGUCHI P & BOBROWSKI R. 2023. Although it lacks connectivity, isolated urban forest fragments can deliver similar amounts of ecosystem services as in protected areas. Cerne 29: e103193. https://doi.org/10.1590/01047760202329013193.
    » https://doi.org/10.1590/01047760202329013193
  • BRASIL-NETO AB, SCHWARTZ G, NORONHA NC, GAMA MAP & FERREIRA GC. 2021. Natural regeneration for restoration of degraded areas after bauxite mining: A case study in the Eastern Amazonian. Ecol Eng 171: 106392. https://doi.org/10.1016/j.ecoleng.2021.106392.
    » https://doi.org/10.1016/j.ecoleng.2021.106392
  • CHEN CC, CHEN CY & WU SH. 2021. Species diversity, taxonomy and multi-gene phylogeny of phlebioid clade (Phanerochaetaceae, Irpicaceae, Meruliaceae) of Polyporales. Fungal Divers 111: 337-442. https://doi.org/10.1007/s13225-021-00490-w.
    » https://doi.org/10.1007/s13225-021-00490-w
  • EGERER M & BUCHHOLZ S. 2021. Reframing urban “wildlife” to promote inclusive conservation science and practice. Biodivers Conserv 30: 2255-2266. https://doi.org/10.1007/s10531-021-02182-y.
    » https://doi.org/10.1007/s10531-021-02182-y
  • FERREIRA LV, MIRANDA ADS, GURGEL ESC, SANTOS JU, BRITO EG & MAIA APM. 2022. A importância do Parque Estadual do Utinga Camilo Viana para a conservação das espécies de plantas e fungos da região metropolitana de Belém, Pará, Brasil. Bol Mus Para Emilio Goeldi Cienc Nat 17: 165-205. https://doi.org/10.46357/bcnaturais.v17i1.779.
    » https://doi.org/10.46357/bcnaturais.v17i1.779
  • GBIF - GLOBAL BIODIVERSITY INFORMATION FACILITY. 2025. Global Biodiversity Information Facility. Available at: https://www.gbif.org Accessed on: January 9, 2026.
    » https://www.gbif.org
  • GUAYASAMIN JM, RIBAS CC, CARNAVAL AC, CARRILLO JD, HOORN C, LOHMANN LG, RIFF D, ULLOA ULLOA C & ALBERT JS. 2024. Evolution of Amazonian biodiversity: A review. Acta Amazon 54: e54bc21360. https://doi.org/10.1590/1809-4392202103601.
    » https://doi.org/10.1590/1809-4392202103601
  • HALL TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41: 95-98.
  • JUSTO A ET AL. 2017. A revised family-level classification of the Polyporales (Basidiomycota). Fungal Biol 121: 798-824. https://doi.org/10.1016/j.funbio.2017.05.010.
    » https://doi.org/10.1016/j.funbio.2017.05.010
  • KATOH K & STANDLEY DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30: 772-780. https://doi.org/10.1093/molbev/mst010.
    » https://doi.org/10.1093/molbev/mst010
  • KORNERUP A & WANSCHER JH. 1978. Methuen handbook of colours, 3rd ed., London: Eyre Methuen, 252 p.
  • LAPOLA DM ET AL. 2023. The drivers and impacts of Amazon forest degradation. Science 379: 6630. https://doi.org/10.1126/science.abp8622.
    » https://doi.org/10.1126/science.abp8622
  • LEMOINE F, CORREIA D, LEFORT V, DOPPELT-AZEROUL O, MAREUIL F, COHEN-BOULAKIA S & GASCUEL O. 2019. NGPhylogeny.fr: new generation phylogenetic services for non-specialists. Nucleic Acids Res 47: W260-W265. https://doi.org/10.1093/nar/gkz303.
    » https://doi.org/10.1093/nar/gkz303
  • LETUNIC I & BORK P. 2024. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res 52: W78-W82. https://doi.org/10.1093/nar/gkae268.
    » https://doi.org/10.1093/nar/gkae268
  • LI Y, CAO YF, NAKASONE KK, LIU SL, HUANG MR & HE SH. 2025. Species diversity, taxonomy, multi-gene phylogeny, and divergence times of Meruliaceae (Polyporales, Basidiomycota). Mycology 16: 1180-1221. https://doi.org/10.1080/21501203.2024.2443216.
    » https://doi.org/10.1080/21501203.2024.2443216
  • LIU ZB & YUAN Y. 2020. Luteoporia citriniporia sp. nov. (Polyporales, Basidiomycota), evidenced by morphological characters and phylogenetic analysis. Phytotaxa 461: 31-39. https://doi.org/10.11646/phytotaxa.461.1.4.
    » https://doi.org/10.11646/phytotaxa.461.1.4
  • LIU ZB, ZHANG JL, PAPP V & DAI YC. 2022. Taxonomy and phylogeny of Meruliaceae with descriptions of two new species from China. JoF 8: 501. https://doi.org/10.3390/jof8050501.
    » https://doi.org/10.3390/jof8050501
  • LUO KY, YUAN Y, LIU HG, GHOBAD-NEJHAD M & DAI YC. 2024. Luteoporia tenuissima sp. nov. (Polyporales, Basidiomycota), evidenced by morphological characteristics and phylogenetic analysis. Phytotaxa 649: 270-278. https://doi.org/10.11646/phytotaxa.649.3.4.
    » https://doi.org/10.11646/phytotaxa.649.3.4
  • MADDISON WP & MADDISON DR. 2023. Mesquite: a modular system for evolutionary analysis. Version 3.81. Available at: https://www.mesquiteproject.org/
    » https://www.mesquiteproject.org/
  • MATA M & RYVARDEN L. 2010. More new and interesting species from Costa Rica. In: Studies in neotropical polypores 27. Synopsis Fungorum 27: 59-72. Available at: https://www.fungiflora.no/synopsis-27.
  • MILLER MA, PFEIFFER W & SCHWARTZ T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Proc Gateway Comput Environ Workshop, p. 1-8. https://doi.org/10.1109/GCE.2010.5676129
    » https://doi.org/10.1109/GCE.2010.5676129
  • MONCALVO JM, LUTZONI FM, REHNER SA, JOHNSON J & VILGALYS R. 2000. Phylogenetic relationships of agaric fungi based on nuclear large subunit ribosomal DNA sequences. Syst Biol 49: 278-305. https://doi.org/10.1093/sysbio/49.2.278.
    » https://doi.org/10.1093/sysbio/49.2.278
  • NISKANEN T ET AL. 2023. Pushing the frontiers of biodiversity research: unveiling the global diversity, distribution, and conservation of fungi. Annu Rev Environ Resour 48: 149-176. https://doi.org/10.1146/annurev-environ-112621-090937.
    » https://doi.org/10.1146/annurev-environ-112621-090937
  • NYLANDER JAA. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University, Uppsala. Available at: https://github.com/nylander/MrModeltest2
    » https://github.com/nylander/MrModeltest2
  • PETCH T. 1922. Annals of the Royal Botanic Gardens, Peradeniya, Vol. VII. Ann R Bot Gard Peradeniya 7: 286. Available at: https://www.biodiversitylibrary.org/item/21756#page/1/mode/1up.
  • RAVEN PH, GEREAU RE, PHILLIPSON PB, CHATELAIN C, JENKINS CN & ULLOA CU. 2020. The distribution of biodiversity richness in the tropics. Sci Adv 6: eabc6228. https://doi.org/10.1126/sciadv.abc6228.
    » https://doi.org/10.1126/sciadv.abc6228
  • RONQUIST F ET AL. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61: 539˗542. https://doi.org/10.1093/sysbio/sys029.
    » https://doi.org/10.1093/sysbio/sys029
  • RYVARDEN L. 1991. Genera of polypores: nomenclature and taxonomy. Synopsis Fungorum 5. Oslo: Fungiflora, 363 p.
  • RYVARDEN L. 2015. Neotropical polypores. Part 3: Polyporaceae Obba–Wrightoporia. Synopsis Fungorum 36. Oslo: Fungiflora, 167 p. Available at: https://www.fungiflora.no/synopsis-36-neotropical-polypore.
  • RYVARDEN L & JOHANSEN I. 1980. A preliminary polypore flora of East Africa. Oslo: Fungiflora. Available at: https://scispace.com/papers/a-preliminary-polypore-flora-of-east-africa-2y6aaogqpo
    » https://scispace.com/papers/a-preliminary-polypore-flora-of-east-africa-2y6aaogqpo
  • SEMAS - SECRETARIA DE ESTADO DE MEIO AMBIENTE E SUSTENTABILIDADE. 2013. Plano de Manejo do Parque Estadual do Utinga (PEUt). Belém: Secretaria de Estado de Meio Ambiente e Sustentabilidade. Available at: https://ideflorbio.pa.gov.br/wp-content/uploads/2025/06/PLANO-DE-MANEJO-PARQUE-DO-UTINGA-2013.pdf. Accessed on: January 9, 2026.
    » https://ideflorbio.pa.gov.br/wp-content/uploads/2025/06/PLANO-DE-MANEJO-PARQUE-DO-UTINGA-2013.pdf.
  • SILVA AL, LONGO RM, BRESSANE A & CARVALHO MFH. 2019. Classification of urban forest fragments based on landscape metrics. Cienc Flor 29: 1254-1269. https://doi.org/10.5902/1980509830201.
    » https://doi.org/10.5902/1980509830201
  • STAMATAKIS A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30: 1312-1313. https://doi.org/10.1093/bioinformatics/btu033.
    » https://doi.org/10.1093/bioinformatics/btu033
  • SWOFFORD DL. 2002. PAUP: phylogenetic analysis using parsimony (and other methods), version 4.0b10. Sinauer Associates, Sunderland, MA. Available at: http://phylosolutions.com/paup-test/
    » http://phylosolutions.com/paup-test/
  • TAMURA K, STECHER G & KUMAR S. 2021. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38: 3022-3027. https://doi.org/10.1093/molbev/msab120.
    » https://doi.org/10.1093/molbev/msab120
  • TEIXEIRA AR. 1995. Método para estudo das hifas basidiocarpo de fungos poliporáceos. Instituto de Botânica 6: 20.
  • WHITE TJ, BRUNS T, LEE S & TAYLOR JW. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA et al. (Eds), PCR protocols: a guide to methods and applications. San Diego: Academic Press, p. 315-322.
  • WU F, YUAN Y, CHEN JJ & HE SH. 2016. Luteoporia albomarginata gen. et sp. nov. (Meruliaceae, Basidiomycota) from tropical China. Phytotaxa 263: 31˗41. https://doi.org/10.11646/phytotaxa.263.1.3.
    » https://doi.org/10.11646/phytotaxa.263.1.3
  • ZHANG X ET AL. 2024. Molecular and morphological data reveal two new polypores (Polyporales, Basidiomycota) with reddish brown to orange basidiomata from China. MycoKeys 107: 75-94. https://doi.org/10.3897/mycokeys.107.126176.
    » https://doi.org/10.3897/mycokeys.107.126176
  • ZHAO C, QU M, HUANG R & KARUNARATHNA SC. 2023. Multi-gene phylogeny and taxonomy of the wood-rotting fungal genus Phlebia sensu lato. J Fungi 9: 320. https://doi.org/10.3390/jof9030320.
    » https://doi.org/10.3390/jof9030320
  • ZHAO H, YUAN HS, CUI YJ, WANG K, WU F, DAI YC & YUAN Y. 2026. Global polypore diversity and distribution patterns. Fungal Diversity 136: 136002.17. https://doi.org/10.65390/fdiv.2026.136002.
    » https://doi.org/10.65390/fdiv.2026.136002
  • ZHOU HM, YANG X, WANG YY & ZHAO CL. 2024. Morphological and molecular identification of two new wood-inhabiting macrofungi (Basidiomycota) from Yunnan–Guizhou Plateau, China. Phytotaxa 674: 1˗17. https://doi.org/10.3897/mycokeys.131.192179.
    » https://doi.org/10.3897/mycokeys.131.192179

Correspondence

Correspondence to: Adriene Mayra da Silva Soares adriene.soares@ufra.edu.br

Handling editor

Patrik Viana

Publication Dates

  • Publication in this collection
    21 Sept 2026
  • Date of issue
    2026

History

  • Received
    13 Jan 2026
  • Accepted
    20 May 2026
Creative Common - by 4.0
This is an open-access article distributed under the terms of the Creative Commons Attribution License
location_on
Academia Brasileira de Ciências Rua Anfilófio de Carvalho, 29, 3º andar, 20030-060 Rio de Janeiro RJ Brasil, Tel: +55 (21) 2391-7901 - Rio de Janeiro - RJ - Brazil
E-mail: aabc@abc.org.br
rss_feed Stay informed of issues for this journal through your RSS reader
Report error