Temperature Drives Microbial Dynamics during the ripening of Serrano Artisanal Cheese

Abstract

This study investigated the impact of ripening temperature on the microbial diversity of Serrano artisanal cheese (SAC), a raw milk specialty from southern Brazil. Despite its cultural and economic significance, the effects of ripening conditions on SAC microbiota remain underexplored, particularly in unpasteurized dairy products. Cheese maturation was conducted at 5°C, 12.5°C, and 20°C for 60 days, with microbial assessments every 15 days using metabarcoding (16S rDNA and ITS sequencing). The results revealed temperature-dependent shifts in bacterial and fungal communities. Maturation at 5°C favored the proliferation of pathogens associated with raw milk contamination, while higher temperatures reduced pathogenic bacteria and promoted lactic acid bacteria (LAB) (<italic>Enterococcus</italic>, <italic>Lactococcus</italic>, <italic>Lactobacillus</italic>, <italic>Leuconostoc</italic>, and <italic>Streptococcus</italic>), which contribute to pathogen inhibition and sensory quality preservation. Physicochemical analyses demonstrated correlations between temperature, humidity, pH, fat, NaCl, and microbial composition. A review of ripening criteria is recommended, including a reduction in the minimum legally required maturation period (from 60 to 30 days) under controlled temperature conditions, as demonstrated in this study, alongside the implementation of technical regulations and knowledge dissemination to ensure product quality and safety.

Key words
microbial diversity; ripening temperature; serrano artisan cheese; metabarcoding analysis; microbiological composition

INTRODUCTION

The escalating global demand for artisanal dairy products, recognized for their potential as functional foods, underscores the need for deeper insights into their production dynamics (Balkir et al. 2021, Galimberti et al. 2021). Serrano Artisanal Cheese (SAC), a cherished product in southern Brazil, holds historical significance tied to familial production practices using raw milk (Cruz & Menasche 2014, Penna et al. 2021). Ries et al. (2012) estimate that in Rio Grande do Sul (RS) alone, there are approximately 1,500 families dedicated to producing SAC. Despite SAC’s robust flavor profile and regional importance, microbial contamination challenges persist, exacerbated by inconsistent ripening practices and the lack of standardized parameters.

Produced by small farmers without temperature control, SAC faces challenges concerning shape, weight, moisture, and salt content variability, coupled with unpredictable microbiological compositions (Souza et al. 2003). Similarly, obtaining raw milk for the production of SAC faces significant challenges and can present pathogenic bacterial species such as Enterococcus faecalis, Staphylococcus saprophyticus, and Stenotrophomonas maltophilia. These bacteria can come from environmental contamination or insufficient implementation of good agricultural practices on the farm, representing a potential risk of contamination of the final product (Ströher et al. 2024b, c).

Seasonal fluctuations in southern Brazil amplify these dynamics, impacting microbial activity and SAC quality. While Brazilian law mandates cheese maturation above 5°C, Rio Grande do Sul allows ripening at ambient temperatures (Quigley 2013), complicating microbial dynamics further.

The climate of the Campos de Cima da Serra region, where SAC is produced, is classified as Cfb, with an average annual temperature of 14°C, ranging from -10°C to 28°C. In winter, the average is 5°C, and in summer it reaches 14°C. There is no defined dry season and annual rainfall ranges from 1,450 to 1,650 mm, distributed over around 135 rainy days. The relative humidity is around 80.5% (Alvares et al. 2014).

The microbiome of artisanal cheese predominantly comprises lactic acid bacteria (LAB), pivotal for fermentation and cheese characteristics (Abedi & Hashemi 2020, Wang et al. 2021). Therefore, identifying LAB communities in artisanal cheeses is fundamental to understanding how they affect sensory quality during ripening and helping to define the product’s shelf life and safety and quality criteria (Erhardt et al. 2023). However, undesirable microorganisms can jeopardize quality and safety (De Filippis et al. 2018). Understanding the dynamics of bacterial communities during cheese ripening, including non-starter lactic acid bacteria (NSLAB), spoilage, and pathogenic microorganisms, is crucial to guarantee food safety (Lavoie et al. 2012). Advanced methods like metabarcoding analysis offer a sophisticated approach to unraveling the microbial intricacies within artisanal cheeses (Afshari et al. 2020, Yeluri Jonnala et al. 2018).

Recently, the effect of temperature and time on microbiological and physicochemical aspects of SAC was explored (Ströher et al. 2023). However, a deeper analysis of microbial behavior is an important step to understanding the dynamics of important pathogenic and spoilage bacteria in the dairy to properly design safety tools to avoid public health problems. This research pioneers the analysis of SAC microbiota during production and ripening, specifically exploring the impact of different temperatures on microbial dynamics. Here, we aimed to uncover microbial interactions and compositions influenced by three ripening conditions, contributing to the optimization of SAC production practices and the assurance of product quality and safety. We hypothesized that higher temperatures increase the activity of fermenters and this can lead to a harsh environment for pathogens, guaranteeing the safety for consumption.

MATERIALS AND METHODS

Milk production

The farm animals selected for milk production in this study are chosen from breeds that are adapted to the Campos de Cima da Serra region, (Rio Grande do Sul Brazil), the production system, the climate, and environmental conditions. The dairy calves comprise a mix of beef and dairy crossbreeds, including Jersey, crossbred Gir, Girolando, and Holstein. The main source of feed for these animals is the native pasture (Bromus auleticus, Paspalum dilatatum, Paspalum notatum, Andropogon lateralis, Piptochaetium montevidense, Schizachrium tenerum, Briza sp., Melica sp., Trifolium riograndensis and Adesmia sp.) found in the Campos de Cima da Serra region (Rio Grande do Sul 2014). During the winter, supplementary feeding is introduced to the animals’ diet, using cultivated winter pastures such as black oats (Avena strigosa Schreb.) and annual ryegrass (Lolium multiflorum Lam.).

Serrano cheese production

The SAC was meticulously crafted in a cheese facility situated in São Francisco de Paula, within the Campos de Cima da Serra region (RS). Following rigorous standards outlined by the Technical Assistance Company for Rural Extension (EMATER) (Emate 2019), the production commenced with the milking of animals on-site. The freshly obtained milk, maintained at room temperature, was promptly transferred to the cheese facility in sanitized containers and filtered before being introduced into a 300 L stainless steel tank.

In the next phase, an industrial rennet-like substance (recombinant chymosin - Aspergillus niger strain DSM 29546 - HA-LA, Chr. Hansen) was added to the milk within the temperature range of 32 to 35°C, with a proportion of 7 mL per 10 L of milk. Following an interval of 45 to 60 minutes, the curd underwent a meticulous process involving breaking into medium-sized pieces using an industrial shovel. Subsequently, the curd was allowed to rest for approximately 10 minutes before being further broken into smaller pieces, and the whey was meticulously removed manually by the skilled hands of the cheesemaker over a brief two-minute period.

Post this phase, the curd underwent salting using a 22% NaCl brine solution. The residual whey was then extracted from the curd mass utilizing a stainless steel plate pressed against the tank’s wall. The curd mass was then carefully molded into a plastic mold (500 g) wrapped with a synthetic draining cloth, and subjected to a stainless steel press for around eight hours. Following this initial period, the cheese underwent a turning process and was pressed once again for an additional 24 hours. Any excess edges were trimmed, and the cheese embarked on a maturation journey on wooden shelves for a minimum of 60 days. Throughout this ripening phase, daily rotations were conducted to ensure an even and consistent coloration.

Ripening conditions and sampling

The cheeses were matured at three different temperatures: 5, 12.5, and 20°C. A temperature of 5°C is the legal ripening criterion (Rio Grande do Sul 2014). The temperature of 20°C corresponds to the average annual temperature of the region of Rio Grande do Sul, while 12.5°C represents the average between the extremes of 5°C and 20°C. In total, five 500 g pieces of cheese were stored at each temperature, and the samples were taken on days 0, 15, 30, 45, and 60 for analysis. The cheeses were matured in controlled chambers (model TE-371, Tecnal) with forced circulation ventilation. The temperature was monitored by a calibrated thermometer, ensuring stable conditions. During the process, the cheeses were kept out of the light and turned daily, following the traditional practices of the region’s rural properties. The humidity level during the ripening of the SAC was maintained at 75±2%. The selection of these temperatures was based on various considerations.

About 200 g of SAC were collected during each sampling and promptly frozen at -18°C. The frozen samples were then sent (in a Styrofoam box at -18°C), via carrier to the Neoprospecta Pesquisa e Consultoria S.A (Florianópolis, Santa Catarina, Brazil) for metabarcoding analyses.

Physical-chemical analysis of cheese

Moisture determination was conducted by drying the samples in an air oven at a temperature of 105°C until the weight became constant (ISO 2004). The dry extract was calculated based on the ratio between the cheese’s fat content and its total dry extract (Brasil 2008). The pH measurement was performed using a Gehaka model PG2000 pH meter. Titratable acidity was determined using a standardized sodium hydroxide solution with a concentration of 0.1 M (Brasil 2008). The water activity was measured at 20°C using LabSwift equipment (Labswift - Aw 2022). The determination of the percentage of sodium chloride in the cheese samples was conducted using the argentometric method, as described in the Brazilian standard procedure (Brasil 2008). The physicochemical parameters of SAC were analyzed according to the current regulations established by the state of Rio Grande do Sul and Brazil (Brasil 1996, Rio Grande do Sul 2014).

DNA extraction, sequencing, and analyses

Microbial DNA was extracted using a proprietary protocol from Neoprospecta ©. The bacterial identification was carried out by sequencing the V3-V4 region of the 16S rDNA, made with the primers 341F (5’-CCTACGGGRSGCAGCAG-3’) (Wang & Qian 2009) and 806R (5’-GGACTACHVGGGTWTCTAAT-3’) (Caporaso et al. 2012). The fungal identification was made by sequencing the ITS region using the primers ITS1 (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) (White et al. 1990). Libraries were sequenced using a MiSeq Sequencing System (Illumina Inc., USA), through the Neoprospecta© methodologies. The raw reads were processed at Neoprospecta, being assigned at the species level using the NeoRef 16S, a proprietary database that includes sequences belonging to the company and also sequences from the public database GenBank, SILVA, UNITE and Greengenes (Quast et al. 2013, Abarenkov et al. 2024, DeSantis et al. 2006). The received OTU table was analyzed in the R environment, version 4.3.1 (R Development Core Team 2022).

Composition differences between sampled temperatures were identified using non-metric multidimensional scaling (nMDS) to test whether the composition differs between sampling environments. As raw quantitative metabarcoding data may introduce biases, we applied different approaches to data treatment: relative read abundance and frequency of occurrence. Using these two approaches is useful to investigate clusters with inherent different biases (Deagle et al. 2019).

We subsequently applied the envfit function to calculate factor averages of environmental variables (using a Euclidean distance matrix and 999 permutations) in order to define which species contribute to the different groups identified in the nMDS analysis (Rosa et al. 2021). All data were analyzed using the packages vegan (Lahti et al. 2017), corrplot (Liu et al. 2021), and ggplot2 (Wickham 2009).

RESULTS AND DISCUSSION

Influence of SAC ripening temperature on bacterial taxa

Food fermentation, an age-old preservation method, harnesses the production of antimicrobial metabolites to counteract the proliferation of pathogenic microorganisms (Dimidi et al. 2019). Herein, we explore the influence of ripening temperature on SAC, elucidating its impact on microbial dynamics and final product quality.

Our findings unveiled a temperature-dependent modulation of bacterial diversity during the 60-day ripening period. Notably, samples ripened at 5°C exhibited higher bacterial diversity compared to those at 12.5°C and 20°C (Figure 1), consistent with previous studies that showed that microbial diversity tends to decrease during cheese ripening, mainly due to reduction of pH driven by sugar fermentation (McNeil et al. 2013).

Figure 1
Bacteria composition in Serrano artisanal cheese samples over ripening time. RRA: Relative Read Abundance.

However, the maturation at 5°C favors the growth of pathogenic bacteria, as it maintains high humidity and inhibits the development of BAL. This compromises both the safety and sensory quality of cheeses (Settanni & Moschetti 2010, Coelho et al. 2022).

Throughout ripening, a significant decline in the relative abundance of pathogenic taxa was observed across all temperature treatments (Figure 1). Noteworthy reductions were noted in species such as Serratia liquefaciens, Serratia proteamaculans, Staphylococcus aureus, and Obesumbacterium proteus, commonly associated with raw milk contamination and indicative of poor hygiene practices (Schukken et al. 2012, Vautor et al. 2003). Interestingly, higher ripening temperatures corresponded to a more pronounced decline in pathogenic taxa, suggesting a temperature-mediated inhibition of their growth.

On the other hand, the decline in pathogenic bacteria was counterbalanced by a significant increase in LAB, including Enterococcus, Lactococcus, and Lactobacillus, alongside less abundant genera such as Leuconostoc and Streptococcus, across different ripening temperatures (Figure 1). Notably, Enterococcus exhibited a temperature-dependent response, with higher abundances observed at 12.5°C and 20°C, indicating their role in driving fermentation and enhancing sensory properties (Fox et al. 2017, Campagnollo et al. 2018). However, some strains of Enterococcus could be pathogenic, highlighting the need for stringent quality control measures (O’Driscoll & Crank 2015, Guzman Prieto et al. 2016).

Enterococcus resistance to extreme conditions, such as high salt concentrations, varied pH, and high temperatures, makes them prevalent in a variety of environments (Švec et al. 2014, Foulquie et al. 2006). This resistance is also associated with the transmission of antibiotic resistance genes and virulence factors, raising concerns about their safety (Giraffa 2002, Câmara et al. 2020). Species such as Enterococcus faecalis and Enterococcus faecium are opportunistic pathogens, causing serious infections such as bacteremia and endocarditis (Zaheer et al. 2020, Jeeja et al. 2019). Vancomycin resistance, in particular, poses a threat to public health due to the possible spread of these genes through the food chain (Reyes et al. 2016, Terkuran et al. 2019).

However, Enterococcus are LAB with ambiguous characteristics in the food industry. In countries such as Portugal and Italy, they are valued in the production of artisan cheeses and fermented foods, contributing to the development of flavor, aroma, and the production of bacteriocins against pathogens such as Listeria monocytogenes (Foulquie et al. 2006). In addition, they have probiotic properties, being relevant for functional foods (Qiao et al. 2019, Popović et al. 2019). Thus, although Enterococcus has beneficial characteristics for food fermentation, its pathogenic potential and ability to spread antibiotic resistance limit its universal acceptance in the food industry.

However, the genus Enterococcus is widely recognized as a LAB and is often associated with the microbiological safety of fermented products. However, the presence of potentially pathogenic strains highlights the need for comprehensive functional characterization. The influence of artisanal practices and fermentation conditions can significantly impact their composition and functionality, highlighting the importance of careful evaluation to ensure product safety and quality (Giraffa 2003, Prado et al. 2005, Franz et al. 2011, Tsigkrimani et al. 2022).

Lactococcus and Lactobacillus, renowned for their rapid lactic acid production and flavor development capabilities, exhibited differential responses to ripening temperature, underscoring the complex interplay between temperature and microbial dynamics (Cogan et al. 1997, Kiernan et al. 2000). Additionally, Leuconostoc spp., characterized by their hetero-lactic fermentation pathway and contribution to cheese flavor, displayed varying abundances across ripening temperatures (Özcan et al. 2021).

Delamare et al. (2012) found a predominance of Lactobacillus (91%), followed by Lactococcus (7%) and Enterococcus (2%) in SAC. The microbial composition of artisan cheeses varies by type, with genera such as Lactococcus, Streptococcus, Leuconostoc, Enterococcus, and Lactobacillus being frequently identified (Kamimura et al. 2019, Cotter & Beresford, Bruno & Carvalho 2009, Camargo et al. 2020). Specifically, Streptococcus predominates in Marajó, Minas Serro, and Minas Cerrado cheeses; Leuconostoc is prevalent in Coalho and Manteiga; while Lactococcus dominates in Caipira, Minas Canastra, and other Minas varieties (Kamimura et al. 2019). These findings highlight the importance of ripening temperature in microbial dynamics, which influences both the quality and safety of the product.

An analysis of colonial artisanal cheeses from Vale do Taquari-RS identified seven genera of LAB, with Lactococcus lactis predominant. The distribution varies with altitude: Enterococcus italicus prevails at high altitudes, while Lactiplantibacillus plantarum and Lactococcus raffinolactis are more frequent at lower altitudes (Erhardt et al. 2023). De Castro Oliveira et al. (2025) investigated the presence and abundance of pathogenic species of the genera Aeromonas and Vibrio in raw milk cheeses collected directly from producers and local fairs in various municipalities in the state of Rio Grande do Sul, in the southern region of Brazil, with a ripening period of seven days. The detection of these microorganisms in atypical foods for the region suggests an expansion of these genera and indicates a potential increase in the risk of infections associated with emerging pathogens. These studies highlight the importance of a suitable maturing process for cheeses made from raw milk.

The lactic and fungal microbiota of artisan cheeses is unique to each region and property, shaped by local conditions (Sant’Anna et al. 2019, Kamimura et al. 2020, Perin et al. 2017). LAB, predominant in hygienic milk, are responsible for fermentation, coagulation, and sensory characteristics during maturation (Beloti et al. 2015, Steele et al. 2013, Widyastuti et al. 2014). Ubiquitous fungi, found in the soil, milking parlor, and air, also contribute to cheese ripening and may be present on wooden boards, which must be sanitized regularly (Emater 2019). Ströher et al. (2024a) demonstrated that the physical-chemical and microbiological quality of colonial artisanal cheese from Campos de Cima da Serra-RS is linked to the adoption of good manufacturing and agricultural practices. In turn, Erhardt et al. (2022) emphasize the need for further studies to address challenges in implementing these practices in family farming, aiming to minimize contamination risks in artisanal cheeses.

The ripening process of SAC is influenced by factors such as humidity, bacterial contamination, and milk composition, particularly fat and protein content. Practices like turning, external washing, packaging, and sanitizing boards directly affect the sensory and microbiological characteristics of the cheese (Emater 2019).

NMDS ordination analysis and environmental fitting

Both NMDS ordination analyses, based on relative read abundance and frequency of occurrence (Figure 2), revealed distinct structuring of bacterial communities across ripening temperatures, with samples from 5°C exhibiting a composition divergent from those at 12.5°C and 20°C. Notably, significant clustering of taxa associated with 5°C ripening was observed, comprising pathogenic genera such as Pseudomonas sp., Citrobacter sp., Pantoea ananatis, Raoultella terrigena, Kluyvera ascorbata, Serratia liquefaciens, and Serratia proteamaculans. In contrast, samples ripened at 12.5°C and 20°C displayed significant structuring primarily related to the lactic acid bacterium Lacticaseibacillus casei. These findings underscore the inhibitory effect of higher temperatures on pathogenic taxa while favoring the proliferation of beneficial LAB, consistent with previous studies on semi-hard cheeses under similar ripening conditions (Nájera et al. 2021, Pisano et al. 2022).

Figure 2
NMDS ordination analysis with the envfit routine shows that both relative read abundance and frequency of occurrence approaches exhibit the same pattern.

Given that winter temperatures are equal to or lower than 5 °C, which compromises the ripening of SAC, it is essential to standardize the production of the product in the region. This involves the use of air-conditioned chambers for maturation and the implementation of training on good manufacturing practices in the agro-industry and good agricultural practices on farms, as established by the product’s legislation (Ströher et al. 2024c, Rio Grande do Sul 2018), which also impact the quality and safety of the SAC. Ströher et al. (2020) matured colonial cheese and prato cheese (snack) under controlled conditions, without detecting microbiological contamination during the process, which highlights the importance of this control to ensure the final quality of the product.

Similarly, Souza et al. (2003) observed that rain in winter had less effect on the inactivation of total coliforms in the SAC compared to summer, due to the higher temperatures during this period. The reduction of these microorganisms was more effective in controlled environments, as demonstrated in the production of Manchego cheeses, where raising the ripening temperature from 10°C to 20°C significantly increased the reduction of total coliforms (Nunez et al. 1986).

Pretto et al. (2021) estimated the maturation temperature of the SAC at around 10°C, without control. Legislation requires maturation to take place above 5°C (Rio Grande do Sul 2014), but allows it to be done at room temperature (Rio Grande do Sul 2021). This highlights the need for SAC producers to improve temperature control, an essential factor in guaranteeing the standardization and characteristics of the product. In addition, it is imperative to review the temperature standards established by legislation, considering the particularities of small-scale SAC producers.

Ensuring a pathogen-free product is essential when maturing cheese to protect public health and improve its sensory qualities. The fermentative microorganisms driving the process play a pivotal role in combating pathogens by creating an environment hostile to their growth. Besides, optimal temperature parameters are crucial for fermentation efficacy across different food matrices. In semi-hard cheeses, the temperature range of 13 - 25°C is considered optimal for fermentation, highlighting the inefficacy of the 5°C ripening temperature tested herein in controlling pathogens (McNeil et al. 2013).

Influence of ripening temperature on fungal taxa

Analysis of fungal relative abundance (Figure 3) unveiled diverse taxa present across all ripening temperature treatments. Candida zeylanoides predominated at 5°C, reaching its highest relative abundance at Day 30 (99.5%), followed by Cutaneotrichosporon curvatum at 12.5°C, peaking at Day 60 (81.4%), and Penicillium paneum at 20°C, with maximum abundance at Day 60 (97.6%).

Figure 3
Fungal composition in Serrano artisanal cheese samples over ripening time. RRA: Relative Read Abundance.

The varying dominance of fungal taxa in each treatment suggests a temperature-dependent preference, consistent with previous findings highlighting the differential dominance of specific fungal groups across temperature gradients (De Respinis et al. 2023). However, it is essential to acknowledge that multiple variables such as milk type, manufacturing processes, microenvironmental conditions, and geographical factors also influence the microbiota in cheese (De Respinis et al. 2023, Rezaei et al. 2020).

Studies on the microbiota of artisan cheeses from the micro-regions of Canastra (Andrade et al. 2017), Serro (Cardoso et al. 2015) and Salitre (Lima et al. 2009) have identified Debaryomyces hansenii, Kluyveromyces lactis and K. marxianus as yeasts of interest, with potential for use as starter cultures. In addition, Geotrichum candidum plays an important role in Serro and Canastra cheeses, contributing to the formation of a wrinkled texture and intensification of aroma and flavor through enzymatic action (UFLA 2017).

Yeasts encounter specific challenges such as low pH, temperature, water activity, and salt content, with optimal growth occurring between pH 4.5-7.0. Oxygen availability is crucial, with strictly aerobic yeasts surviving but not reproducing in anaerobic conditions. Growth is favored at higher temperatures, between 20°C and 30°C, even though some species can thrive at lower temperatures (2°C to 10°C). Moreover, yeasts exhibit greater tolerance to low water activity compared to bacteria, explaining the variability in fungal genera observed across cheese samples (Fröhlich-Wyder et al. 2019).

Undesirable fungal species pose risks of spoilage in dairy products, manifesting as visible growth on surfaces, production of metabolites leading to unpleasant odors/flavors, or changes in color/texture. Certain spoilage fungi genera like Penicillium and Aspergillus have mycotoxin-producing capabilities, posing health hazards (Filtenborg et al. 1996, Westall et al. 1998). Fungal contamination can occur throughout milk and cheese production stages, including milking parlors, production environments, and even consumers’ homes (Kure & Skaar 2019, Vacheyrou et al. 2011). Notably, several LAB produce metabolites with antifungal properties, contributing to controlling undesirable fungal growth in dairy products (Inglin et al. 2015).

Therefore, interactions between fungi and bacteria play an essential role in the ripening of artisanal cheeses, as well as SAC, directly influencing their sensory characteristics, such as aroma, color, flavor, and texture (Irlinger & Mounier 2009, Fröhlich-Wyder et al. 2019).

Physicochemical analysis SAC

The influence of ripening temperature on the physicochemical parameters of SAC was pronounced (Table I). Higher ripening temperatures were associated with greater moisture loss, indicating a direct correlation between temperature and water content reduction. Moisture loss during ripening is influenced by environmental factors and intrinsic cheese characteristics, with cheese size playing a pivotal role in the rate of moisture loss. Furthermore, water activity (Aw) in SAC exhibited an inverse relationship with moisture levels, where higher Aw levels correlated with an increased risk of product deterioration due to the proliferation of pathogenic deteriorating microorganisms (Taveira et al. 2015).

Table I
Physical-chemical analyses of Serrano Artisanal cheese. *Mean values and standard deviations were obtained from triplicate analyses. *Equal letters on the same line indicate that there is no statistical difference.

Ripening Days	Moisture (%)	Fat (%)	Acidity (g/ ac. Lat)	pH	Fat in Dry Extract (%)	NaCl (%)	Aw
5°C
0	53a±0.48	19a±0.22	0.2a±0.00	6.8a±0.04	40.9a±0.00	0.55a±0.01	0.998a±0.01
15	53a±0.08	21b±0.22	0.24b±0.01	5.92b±0.04	43.31b±0.00	0.58b±0.01	0.984b±0.01
30	41b±0.15	25c±0.44	0.4c±0.00	5.9c±0.04	42.5c±0.00	0.6c±0.01	0.975c±0.01
45	39c±0.02	25c±0.44	0.4c±0.00	5.8d±0.04	40.7a±0.00	0.6c±0.01	0.973c±0.01
60	36d±0.10	28d±0.44	0.77d±0.01	5.7e±0.04	42.97c±0.01	0.8d±0.01	0.968c±0.01
12.5°C
0	53a±0.48	19a±0.22	0.2a±0.01	6.8a±0.04	40.9a±0.00	0.55a±0.01	0.998a±0.01
15	33b±0.03	36b±0.22	0.6b±0.01	5.48b±0.04	54.01b±0.00	0.46b±0.01	0.97b±0.01
30	31c±0.05	31c±0.22	0.8c±0.01	5.1c±0.04	44.8c±0.00	0.8c±0.01	0.946c±0.01
45	29d±0.03	32c±0.22	0.8c±0.01	5.1c±0.04	44.6c±0.00	0.7d±0.01	0.946c±0.01
60	26e±0.02	32c±0.44	1.45d±0.01	4.92d±0.04	42.83c±0.00	1.1e±0.01	0.939d±0.01
20°C
0	53a±0.048	19a±0.22	0.2a±0.01	6.8a±0.004	40.9a±0.00	0.55a±0.01	0.998a±0.01
15	29b±0.02	34b±0.22	0.91b±0.01	5.24b±0.04	48.35b±0.00	0.46b±0.01	0.948b±0.01
30	23c±0.27	35b±0.00	1.11c±0.01	5.0c±0.04	45c±0.00	0.70c±0.01	0.930c±0.01
45	21d±0.07	33c±0.22	1.30d±0.01	5.0d±0.04	41.7d±0.00	1.00d±0.01	0.902d±0.01
60	22e±0.03	33c±0.22	2.09e±0.01	4.94d±0.04	41.95d±0.00	1.10e±0.01	0.900d±0.01

• *Mean values and standard deviations were obtained from triplicate analyses. *Equal letters on the same line indicate that there is no statistical difference.

Moreover, elevating ripening temperature led to increased acidity and NaCl content. Cheese acidity arises from lactic acid production during lactose degradation by bacteria, impacting pH from manufacturing to the onset of ripening (Sousa et al. 2014). Ripening temperature can influence acidity, with factors such as curd grain size, salt amount, salting method, and pressing contributing to its variability (Scott 2002). The rise in NaCl concentration during SAC ripening results from its concentration due to greater moisture loss throughout the process (Taveira et al. 2015). Higher ripening temperatures were associated with lower cheese pH, with cheeses matured at 5°C on Day 60 exhibiting a pH of 5.7, while those at 12.5°C and 20°C showed pH values of 4.92 and 4.94, respectively.

Additionally, fat content increased across all ripening times and temperatures evaluated. On Day 60, cheese matured at 5°C had a fat content of 28%, whereas those at 12.5°C and 20°C had fat contents of 32±0.04% and 33±0.02%, respectively. The increment in fat concentration during ripening is attributed to moisture loss, allowing for higher total solids levels (Sousa et al. 2014). Notably, fat content in the dry extract exhibited similarities across all ripening temperatures (5°C, 12.5°C, and 20°C), with values of 42.97±0.00%, 42.83±0.06%, and 41.95±0.03%, respectively. Fat content in the dry extract is determined by the ratio between fat content and total dry extract of the cheese.

Correlation of physicochemical and metabarcoding analyses of the SAC

Significant correlations between physicochemical parameters and microbial abundance in SAC were observed (Figure 4). Moisture content exhibited a strong negative correlation with fat and acidity and a moderate negative correlation with NaCl content. Conversely, moisture showed strong positive correlations with pH and water activity (Aw). Additionally, moderate positive correlations were found between moisture and the abundance of pathogenic bacterial genera such as Rahnella and Serratia, as well as Streptococcus. This is in line with the findings of Ströher et al. (2023) who observed that the main physicochemical parameters that influence foodborne bacteria in SAC (thermotolerant and total coliforms, as well as positive coagulase Staphylococcus) are high moisture, pH and Aw.

Figure 4
Correlation between lactic bacteria and milk factors in milk used in the manufacturing of Serrano artisanal cheese. The chromatic representation of the scale bar is used to indicate the nature of the correlation, where the value 1 is associated with a perfect positive correlation (represented by a shade of dark blue), while the value -1 represents a perfect negative correlation (expressed by a shade of dark red).

Fat content demonstrated moderate positive correlations with acidity and the presence of the bacterial genus Lactococcus while exhibiting negative correlations with pH, Aw, and the bacterial genera Serratia and Streptococcus. Acidity exhibited strong negative correlations with pH and Aw, and a strong positive correlation with NaCl content, along with a moderate positive correlation with the fungal genus Penicillium. Fungi generally are adapted to acid and low Aw conditions, and the concentration of organic acids and salt showed not to be a barrier to Penicillium growth (Nelson & Cox 2018). Notably, pH showed moderate negative correlations with NaCl and Aw, while Aw exhibited strong positive correlations with the bacterial genera Serratia and Streptococcus. Additionally, a moderate negative correlation was observed between NaCl content and Aw, as well as with the bacterial genus Pantoea. Reduction of moisture and Aw implies the concentration of important compounds such as salt and acids in cheeses during ripening consequently reducing pH and increasing acidity (Damodaran & Parkin 2018). Demirci et al. (2021) observed that Streptococcus spp. was found as a prevalent species of LAB at the end of the maturation period of Tulum cheeses, showing to be an adapted genus to cheese maturation conditions.

Positive correlations were found between Aw and various bacterial genera, including Serratia, Enterococcus, Lactococcus, and Staphylococcus. Moreover, moderate positive correlations were identified between the genera Leuconostoc and Geotrichum, Lactobacillus and Cladosporium, and Pantoea and Cladosporium, as well as between Serratia and Staphylococcus. Lastly, positive correlations were observed between Kurtzmaniella spp. and Tricholoma spp., as well as between Geotrichum spp. and Yarrowia spp. Results indicate a possible synergic behavior of these bacteria which should be better explored in further works.

These findings contribute to a deeper comprehension of SAC ripening and quality processes, offering insights for enhancing production, ripening, and quality control. Moreover, they establish a robust foundation for future investigations and advancements in SAC production methodologies.

CONCLUSIONS

This study showed that the ripening temperature significantly influences the bacterial and fungal microbiota of Serrano Artisan Cheese (SAC), affecting its safety and quality. Maturation at 5°C proved to be inadequate, as it favored the proliferation of potentially pathogenic bacteria, such as Pseudomonas sp., Citrobacter sp., Pantoea ananatis, Raoultella terrigena, Kluyvera ascorbata, Serratia liquefaciens and Serratia proteamaculans, as well as inhibiting the growth of beneficial LAB. In contrast, temperatures of 12.5°C and 20°C provided a more balanced microbiota, with a predominance of Lacticaseibacillus casei, whose beneficial effects include inactivating pathogens and preserving the sensory and functional characteristics of the cheese, as well as significantly reducing the abundance of fungi.

The physicochemical analyses showed correlations between temperature, humidity, pH, fat content, NaCl content, and microbial composition, reinforcing the need for strict control of these parameters. In addition, the physicochemical analyses highlight the importance of maintaining ideal temperature conditions, since higher temperatures were associated with a higher fat and NaCl content, as well as reduced pH and humidity levels, essential factors for the quality of the final product. A positive correlation was observed between physicochemical parameters and microbial abundance in the SAC, showing significant relationships, such as the association between humidity and pH, Aw and pathogenic genera such as Rahnella, Serratia, and Streptococcus. Fat content was correlated with acidity and Lactococcus, while acidity was associated with NaCl and Penicillium. In addition, Aw correlated with several bacterial genera, including Serratia and Streptococcus.

The seasonal variation in temperatures in the Campos de Cima da Serra region, combined with the lack of adequate infrastructure, such as air-conditioned maturing rooms, compromises the standardization of SAC, impacting its quality and microbiological safety. These findings highlight the need for strict control not only of temperature and ripening time but also of humidity and good manufacturing practices and their standardization, guaranteeing the safety and quality of the SAC.

Because of this, it is recommended that the regulatory criteria for ripening be reviewed, including assessing the feasibility of reducing the minimum time required by legislation under ideal thermal conditions. In addition, the formulation of specific technical regulations, defining physicochemical and microbiological parameters, is essential to guarantee the quality and safety of the SAC. Finally, disseminating technical knowledge through lectures and educational materials, such as a practical production guide, is essential to guide producers and promote the standardization of processes, contributing to the enhancement and sustainability of SAC production on farms.

Acknowledgements

Authors are thankful for the Fundação de Amparo à Pesquisa do Rio Grande do Sul (FAPERGS, RS, Brazil) for the financial support and CIK has been funded by The Novo Nordisk Foundation, grant number NNF20CC0035580.

References

• ABARENKOV K, NILSSON RH, LARSSON KH, TAYLOR AF, MAY TW, FRØSLEV TG, PAWLOWSKA J, LINDAHL B, PÕLDMAA K, TRUONG C & PAWLOWSKA J. 2024. The UNITE database for molecular identification and taxonomic communication of fungi and other eukaryotes: sequences, taxa and classifications reconsidered. Nucleic Acids Res 52(D1): D791-D797.
• ABEDI E & HASHEMI SMB. 2020. Lactic acid production – producing microorganisms and substrates sources-state of art. Heliyon 6(10).
• AFSHARI R, PILLIDGE CJ, DIAS D, OSBORN AM, & GILL H. 2020. Cheesomics: the future pathway to understanding cheese flavour and quality. Crit Rev Food Sci Nutr 60(1): 33-47.
• ALVARES CA, STAPE JL, SENTELHAS PC, GONÇALVES JDM & SPAROVEK G. 2014. Köppen’s climate classification map for Brazil. Meteorologische Zeitschrift, Garmisch-Partenkirchen 22(6): 711728.
• ANDRADE RP, MELO CN, GENISHEVA Z, SCHWAN RF & DUARTE WF. 2017. Yeasts from Canastra cheese production process: isolation and evaluation of their potential for cheese whey fermentation. Food Res Int 91: 72-79.
• BALKIR P, KEMAHLIOGLU K & YUCEL U. 2021. Foodomics: A new approach in food quality and safety. Trends Food Sci Technol 108: 49-57.
• BELOTI V, TAMANINI R, NERO L, MOREIRA M, SILVA L & FAGNANNI R. 2015. Leite: Obtenção, inspeção e Qualidade. Londrina: Editora Planta.
• BRASIL. 1996. Ordinance 146, of March 11, 1996. https://www.defesa.agricultura.sp.gov.br/legislacoes/portaria-mapa-146-de-07-03-1996,669.html
  » https://www.defesa.agricultura.sp.gov.br/legislacoes/portaria-mapa-146-de-07-03-1996,669.html
• BRASIL. 2008. Physical Chemical Methods for Food Analysis. wp.ufpel.edu.br/nutricaobromatologia/files/2013/07/NormasADOLFOLUTZ.pdf. 2008.
• BRUNO LM & CARVALHO JDG. 2009. Microbiota Lática de Queijos Artesanais 1. Fortaleza: Embrapa Agroindústria Tropical.
• CÂMARA SPA, DAPKEVICIUS A, SILVA CCG, MALCATA FX & ENES DAPKEVICIUS MLN. 2020. Artisanal Pico cheese as reservoir of Enterococcus species possessing virulence and antibiotic resistance properties: Implications for food safety. Food Biotechnol 34: 25-41.
• CAMARGO AC, COSTA EA, FUSIEGER A, DE FREITAS R, NERO LA & DE CARVALHO AF. 2020. Microbial shifts through the ripening of the “Entre Serras” Minas artisanal cheese monitored by high-throughput sequencing. Food Res Int 139: https://doi.org/10.1016/j.foodres.2020.109803.
  » https://doi.org/10.1016/j.foodres.2020.109803
• CAMPAGNOLLO FB, MARGALHO LP, KAMIMURA BA, FELICIANO MD, FREIRE L, LOPES LS & SANT’ANA AS. 2018. Selection of indigenous lactic acid bacteria presenting anti-listerial activity, and their role in reducing the maturation period and assuring the safety of traditional Brazilian cheeses. Food Microbiol 73: 288-297.
• CAPORASO JG, LAUBER CL, WALTERS WA, BERG-LYONS D, HUNTLEY J, FIERER N & KNIGHT R. 2012. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME J 6(8): 1621-1624.
• CARDOSO VM, BORELLI BM, LARA CA, SOARES MA, PATARO C, BODEVAN EC & ROSA CA. 2015. The influence of seasons and ripening time on yeast communities of a traditional Brazilian cheese. Food Res Int 69: 331-340.
• COELHO MC, MALCATA FX & SILVA CCG. 2022. Lactic acid bacteria in raw-milk cheeses: From starter cultures to probiotic functions. Foods 11(15): 2276.
• COGAN TM, BARBOSA M, BEUVIER E, BIANCHI-SALVADORI B, COCCONCELLI PS, FERNANDES I & RODRÍGUEZ E. 1997. Characterization of the lactic acid bacteria in artisanal dairy products. J Dairy R 64(3): 409-421.
• COTTER PD & BERESFORD TP. 2017. Chapter 15 - microbiome changes during ripening. In: McSweeney PLH, Fox PF, Cotter PD & Everett DW (Eds), Cheese, 4th ed., San Diego: Academic Press, p. 389-409.
• CRUZ FT DA & MENASCHE R. 2014. O debate em torno dos queijos de leite cru: entre os aspectos regulatórios e a valorização da produção tradicional. Vigil Sanit Debate 2(4): 34-42.
• DAMODARAN S & PARKIN KL. 2018. Química de alimentos de Fennema. Artmed Editora.
• DE CASTRO OLIVEIRA W, MARQUES PH, ERHARDT MM, FELICE AG, TRISTÃO CLAM, ABURJAILE FF, OLIVEIRA MBPP & RICHARDS NSPS. 2025. Metagenomic analysis and proteins prediction of emerging pathogens in artisanal cheese. Mol Divers.
• DE FILIPPIS F, PARENTE E & ERCOLINI D. 2018. Recent Past, Present, and Future of the Food Microbiome. Ann Rev Food Sci Technol 9(1): 589-608.
• DE RESPINIS S, CAMINADA A, PIANTA E, BUETTI-DINH A, RIVA SCETTRINI P, PETRINI L & PETRINI O. 2023. Fungal communities on alpine cheese rinds in Southern Switzerland. Bot Studies 64(1): 6.
• DEAGLE BE, THOMAS AC, MCINNES JC, CLARKE LJ, VESTERINEN EJ, CLARE EL & EVESON JP. 2019. Counting with DNA in metabarcoding studies: How should we convert sequence reads to dietary data? Molecular Ecol 28(2): 391-406.
• DELAMARE APL, DE ANDRADE CCP, MANDELLI F, DE ALMEIDA RC & ECHEVERRIGARAY S. 2012. Microbiological, physico-chemical and sensorial characteristics of Serrano, an artisanal Brazilian cheese. Food Nutr Sci 3(8): 1068.
• DEMIRCI T, AKIN N, ATIK DS, ÖZKAN ER, DERTLI E & AKYOL İ. 2021. Lactic acid bacteria diversity and dynamics during ripening of traditional Turkish goatskin Tulum cheese produced in Mut region assessed by culturing and PCR-DGGE. LWT 138: 110701.
• DESANTIS TZ, HUGENHOLTZ P, LARSEN N, ROJAS M, BRODIE EL, KELLER K, HUBER T, DALEVI D, HU P & ANDERSEN GL. 2006. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol 72(7): 5069-5072.
• DIMIDI E, COX SR, ROSSI M & WHELAN K. 2019. Fermented Foods: Definitions and Characteristics, Impact on the Gut Microbiota and Effects on Gastrointestinal Health and Disease. Nutrients 11(8): 1806.
• EMATER/RS-ASCAR. 2019. Boas práticas de fabricação na produção de Queijo Artesanal Serrano. [Elaborada por] João Carlos Santos da Luz. Porto Alegre, RS: EMATER/RS-ASCAR, 38 p.
• ERHARDT MM, FRÖDER H, DE CASTRO OLIVEIRA W, STRÖHER JA, SAVERGNINI PR, DOS SANTOS VZ & RICHARDS NSPDS. 2022. Avaliação físico-química e microbiológica de queijos artesanais a partir de leite cru e verificação de boas práticas em propriedades rurais no Vale do Taquari-RS. Res Soc Develop 11(13): e253111335290-e253111335290.
• ERHARDT MM, OLIVEIRA WDC, FRÖDER H, MARQUES PH, OLIVEIRA MBPP & RICHARDS NSPDS. 2023. Lactic bacteria in artisanal cheese: Characterization through metagenomics. Fermentation 9(1) 41.
• FILTENBORG O, FRISVAD JC & THRANE U. 1996. Moulds in food spoilage. International J Food Microbiol Spec Spoil Organ 33(1): 85-102.
• FOULQUIÉ MORENO MR, SARANTINOPOULOS P, TSAKALIDOU E & DE VUYST L. 2006. The role and application of enterococci in food and health. Int J Food Microbiol 106: 1-24.
• FOX PF, GUINEE TP, COGAN TM & MCSWEENEY PLH. 2017. Fundamentals of Cheese Science. Boston, MA: Springer US.
• FRANZ CMAP, HUCH, M, ABRIOUEL H, HOLZAPFEL W & GÁLVEZ A. 2011. Enterococci as probiotics and their implications in food safety. Int J Food Microbiol 151(2): 125-140.
• FRÖHLICH-WYDER MT, ARIAS-ROTH E & JAKOB E. 2019. Cheese yeasts. Yeast 36(3): 129-141.
• GALIMBERTI A, BRUNO A, AGOSTINETTO G, CASIRAGHI M, GUZZETTI L & LABRA M. 2021. Fermented food products in the era of globalization: tradition meets biotechnology innovations. Current Opinion in Biotechnology, Food Biotechnology. Plant Biotechnol 70: 36-41.
• GIRAFFA G. 2002. Enterococci from foods. EMS Microbiol Rev 26: 163-171.
• GIRAFFA G. 2003. Functionality of enterococci in dairy products. Int J Food Microbiol 88(2-3): 215-222.
• GUZMAN PRIETO AM, VAN SCHAIK W, ROGERS MR, COQUE TM, BAQUERO F, CORANDER J & WILLEMS RJ. 2016. Global Emergence and Dissemination of Enterococci as Nosocomial Pathogens: Attack of the Clones? Front Microbiol 7.
• INGLIN RC, STEVENS MJ, MEILE L, LACROIX C & MEILE L. 2015. High-throughput screening assays for antibacterial and antifungal activities of Lactobacillus species. J Microbiol Meth 114: 26-29.
• IRLINGER F & MOUNIER J. 2009. Microbial interactions in cheese: implications for cheese quality and safety. Curr Opin Biotechnol 20(2): 142-148.
• ISO - INTERNATIONAL ORGANIZATION FOR STANDARDIZATION. 2004. ISO 5534 | IDF 04:2004. Cheese and processed cheese - Determination of the total solids content (Reference method). Geneva: ISO.
• JEEJA V. 2019. Characterization of food and clinical isolates of enterococci. Acta Sci Microbiol 2: 56-61.
• KAMIMURA BA, CABRAL L, NORONHA MF, BAPTISTA RC, NASCIMENTO HM & SANT’ANA AS. 2020. Amplicon sequencing reveals the bacterial diversity in milk, dairy premises and Serra da Canastra artisanal cheeses produced by three different farms. Food Microbiol 89: 103453.
• KAMIMURA BA, DE FILIPPIS F, SANT’ANA AS & ERCOLINI D. 2019. Large-scale mapping of microbial diversity in artisanal Brazilian cheeses. Food Microbiol 80: 40-49.
• KIERNAN RC, BERESFORD TP, O’CUINN G & JORDAN KN. 2000. Autolysis of Lactobacilli during Cheddar Cheese Ripening. Irish J Agricul Food Res 39(1): 95-106.
• KURE CF & SKAAR I. 2019. The fungal problem in cheese industry. Current Opinion in Food Science, Trends in sustainable food processing. Food Mycol 29: 14-19.
• LAHTI L, SHETTY S, BLAKE T & SALOJARVI J. 2017. Microbiome R Package. Tools Microbiome Anal R.
• LAVOIE K, TOUCHETTE M, ST-GELAIS D & LABRIE S. 2012. Characterization of the fungal microflora in raw milk and specialty cheeses of the province of Quebec. Dairy Sci Technol 92(5): 455-468.
• LIMA CDLC, LIMA LA, CERQUEIRA MMOP, FERREIRA EG & ROSA CA. 2009. Bactérias do ácido láctico e leveduras associadas com o queijo-de-minas artesanal produzido na região da Serra do Salitre, Minas Gerais. Arquivos Bras Med Vet Zootec 61: 266-272.
• LIU C, CUI Y, LI X & YAO. 2021. Microeco: an R package for data mining in microbial community ecology. FEMS Microbiol Ecol 97(2): fiaa255.
• MCNEIL B, HARVEY LM, ROWAN NJ & GIAVASIS I. 2013. Fermentation monitoring and control of microbial cultures for food ingredient manufacture. In: Microbial production of food ingredients, enzymes and nutraceuticals. Woodhead Publishing, p. 125-143.
• NÁJERA AI, NIETO S, BARRON LJR & ALBISU M. 2021. A Review of the Preservation of Hard and Semi-Hard Cheeses: Quality and Safety. Int J Environ Res Pub Health 18(18): 9789.
• NELSON DL & COX MM. 2018. Leninger princípios de bioquímica. Em: Leninger princípios de bioquímica. [s.l: s.n.]. p. 975-975.
• NUNEZ M, GARCIA-ASER C, RODRIGUEZ-MARTIN MA, MEDINA M & GAYA P. 1986. The effect of ripening and cooking temperatures on proteolysis and lipolysis in Manchego cheese. Food Chem 21(2): 115-123.
• O’DRISCOLL T & CRANK CW. 2015. Vancomycin-resistant enterococcal infections: epidemiology, clinical manifestations, and optimal management. Infect Drug Resist 8: 217-230.
• ÖZCAN E, SEVEN M, ŞİRIN B, ÇAKIR T, NIKEREL E, TEUSINK B & TOKSOY ÖNER. 2021. Dynamic co-culture metabolic models reveal the fermentation dynamics, metabolic capacities and interplays of cheese starter cultures. Biotechnol Bioeng 118(1): 223-237.
• PENNA ALB, GIGANTE ML & TODOROV SD. 2021. Artisanal Brazilian Cheeses-History, Marketing, Technological and Microbiological Aspects. Foods 10(7): 1562.
• PERIN LM, SARDARO MLS, NERO LA, NEVIANI E & GATTI M. 2017. Bacterial ecology of artisanal Minas cheeses assessed by culture-dependent and -independent methods. Food Microbiol 65: 160-169.
• PISANO MB, FADDA ME, VIALE S, DEPLANO M, MEREU F, BLAŽIĆ M & COSENTINO S. 2022. Inhibitory Effect of Lactiplantibacillusplantarum and Lactococcus lactis Autochtonous Strains against Listeria monocytogenes in a Laboratory Cheese Model. Food 11(5): 715.
• POPOVIĆ N, DJOKIĆ J, BRDARIĆ E, DINIĆ M, TERZIĆ-VIDOJEVIĆ A, GOLIĆ N & VELJOVIĆ K. 2019. The influence of heat-killed Enterococcus faecium BGPAS1-3 on the tight junction protein expression and immune function in differentiated Caco-2 cells infected with Listeria monocytogenes ATCC 19111. Front Microbiol 10: 412.
• PRADO MR, BLANDÓN LM, VANDENBERGHE LP, RODRIGUES C, CASTRO GR, THOMAZ-SOCCOL V & SOCCOL CR. 2005. Milk kefir: composition, microbial cultures, biological activities, and related products. Front Microbiol 6: 1177.
• PRETTO ÂN, RECK C, MENIN Á & SANT’ANNA V. 2021. Kinetic modeling of inactivation of foodborne bacterial pathogens in serrano artisanal chesse during ripening. Braz J Food Technol 24: e2019322.
• QIAO X, DU R, WANG Y, HAN Y & ZHOU Z. 2019. Isolation, characterisation and fermentation optimisation of bacteriocin-producing Enterococcus faecium Waste Biomass Valorization 11: 3173-3181.
• QUAST C, PRUESSE E, YILMAZ P, GERKEN J, SCHWEER T, YARZA P, PEPLIES J & GLÖCKNER FO. 2012. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res 41(D1): D590-D596.
• QUIGLEY L, O’SULLIVAN O, STANTON C, BERESFORD TP, ROSS RP, FITZGERALD GF & COTTER P D. 2013. The complex microbiota of raw milk. FEMS Microbiol Rev 37(5): 664-698.
• R DEVELOPMENT CORE TEAM. 2022. “R: A Language and Environment for Statistical Computing”.
• REYES K, BARDOSSY, AC & ZERVOS M. 2016. Vancomycin-resistant enterococci Epidemiology, infection, prevention and control. Infect Dis Clin North Am 30: 953-965.
• REZAEI A, ALIREZALU K, DAMIRCHI S A, HESARI J, PAPADEMAS P, DOMÍNGUEZ R & YAGHOUBI M. 2020. Effect of Pasteurization and Ripening Temperature on Chemical and Sensory Characteristics of Traditional Motal Cheese. Fermentation 6(4): 95.
• RIES JE, DA LUZ JSC & WAGNER SA. 2012. Projeto de qualificação e certificação do queijo serrano produzido nos Campos de Cima da Serra do Rio Grande do Sul-relato parcial da experiência. Agroeco Desenvolv Rural Sust 5(1): 10-19.
• RIO GRANDE DO SUL. 2014. Instrução Normativa n.º 07 de 09/12/2014. Aprova o Regulamento Técnico de Identidade e Qualidade do Queijo Serrano. Diário Oficial do Estado. Diário Oficial do Estado, Porto Alegre, 14 de dez. de 2014.
• RIO GRANDE DO SUL. 2021. Lei Ordinária 15.615, de 2021. Dispõe sobre a produção e comercialização de queijos artesanais de leite cru e dá outras providências.
• ROSA FDAS, BAILLIE C, MEDEIROS TDN & READY JS. 2021. Habitat and host associations of the fish-burrowing parasite Artystone minima (Cymothoidae: Isopoda) in eastern Amazonia. Biotropica 53(1): 307-316.
• SANT’ANNA FM, WETZELS SU, CICCO SHS, FIGUEIREDO RC, SALES GA, FIGUEIREDO NC & SOUZA MR. 2019. Microbial shifts in Minas artisanal cheeses from the Serra do Salitre region of Minas Gerais, Brazil throughout ripening time. Food Microbiol 82: 349-362.
• SCHUKKEN Y, CHUFF M, MORONI P, GURJAR A, SANTISTEBAN C, WELCOME F & ZADOKS R. 2012. The “Other” Gram-Negative Bacteria in Mastitis: Klebsiella, Serratia, and More. Veterinary Clinics: Food Anim Pract 28(2): 239-256.
• SCOTT R. 2002. Fabricación de queso, 2nd ed., Zaragoza - Espanha
• SETTANNI L & MOSCHETTI G. 2010. Non-starter lactic acid bacteria used to improve cheese quality and provide health benefits. Food Microbiol 27(6): 691-697.
• SOUSA AZBD, ABRANTES MR, SAKAMOTO SM, SILVA JBAD, LIMA PDO, LIMA RND & PASSOS YDB. 2014. Aspectos físico-químicos e microbiológicos de queijos de coalho comercializados em estados do nordeste brasileiro. Arq Inst Biol 81: 30-35.
• SOUZA CFVD, DALLA ROSA T & AYUB MAZ. 2003. Changes in the microbiological and physicochemical characteristics of Serrano cheese during manufacture and ripening. Braz J Microbiol 34: 260-266.
• STEELE J, BROADBENT J & KOK J. 2013. Perspectives on the contribution of lactic acid bacteria to cheese flavor development. Curr Opin Biotechnol 24(2): 135-141.
• STRÖHER JA, BENINCA T, PADILHA RL, DOS SANTOS NUNES I & DOS SANTOS JR LCO. 2024a. Atributos de qualidade do leite cru refrigerado e do Queijo Colonial Artesanal (QAC) do Rio Grande do Sul: um estudo de caso. Rev Agron Meio Amb 17(4): e11602-e11602.
• STRÖHER JA, DOS SANTOS JR LCO, CAXAMBU S, PADILHA RL, ERHARDT MM & VOGEL J. 2020. Avaliação microbiológica e da perda de peso durante a maturação de queijos prato (lanche) e colonial de uma agroindústria da Serra Gaúcha–RS. Braz Appl Sci Rev 4(6): 3556-3568.
• STRÖHER JA, DOS SANTOS JR LCO, DE FREITAS AS, DOS SANTOS NUNES I & PADILHA RL. 2024b. Qualidade do leite cru refrigerado para produção de Queijo Artesanal Serrano (QAS) no RS: um estudo de caso. Rev Semiárido Visu 12(1): 162-177.
• STRÖHER JA, DOS SANTOS JR LCO, DE FREITAS AS, DOS SANTOS NUNES I & PADILHA RL. 2024c. Avaliação de boas práticas agrícolas (BPA) e de fabricação (BPF) em uma agroindústria de Queijo Artesanal Serrano (QAS) no Rio Grande do Sul (RS). Rev Ciênc Agríc 22: e15198-e15198.
• STRÖHER JA, SANT’ANNA V, OLIVEIRA WDC & PADILHA RL. 2023. The Effect of Temperature on Physicochemical and Microbiological Aspects of Serrano Artisanal Cheese Ripening. Braz Arch Biol Technol 66: e23220530.
• ŠVEC P & FRANZ CMAP. 2014. The genus Enterococcus Lactic Acid Bact: Biodivers Taxon: 175-211.
• TAVEIRA LB, COSTA RGB, JÚNIOR LCGC, SOBRAL D & DE PAULA JCJ. 2015. Distribuição de NaCl no queijo reino ao longo da maturação. Rev Inst Laticínios Cândido Tostes 70(3): 141-149.
• TERKURAN M, TURHAN EÜ & ERGINKAYA Z. 2019. The risk of vancomycin resistant enterococci infections from food industry. Health Safety Aspects Food Process Technol, p. 513-535.
• TSIGKRIMANI M, PANAGIOTAREA K, PARAMITHIOTIS S, BOSNEA L, PAPPA E, DROSINOS EH & MATARAGAS M. 2022. Microbial ecology of sheep milk, artisanal feta, and kefalograviera cheeses. Part II: technological, safety, and probiotic attributes of lactic acid bacteria isolates. Foods 11(3): 459.
• UFLA - UNIVERSIDADE FEDERAL DE LAVRAS. 2017. Pesquisa da UFLA identifica fungo em queijo tradicional de Minas. Universidade Federal de Lavras. Available in: <https://ufla.br/arquivo-de-noticias/10591-pesquisa-da-ufla-identifica-fungo-em-queijo-tradicional-de-minas>. Accessed on: 15 Feb. 2025.
  » https://ufla.br/arquivo-de-noticias/10591-pesquisa-da-ufla-identifica-fungo-em-queijo-tradicional-de-minas
• VACHEYROU M, NORMAND AC, GUYOT P, CASSAGNE C, PIARROUX R & BOUTON Y. 2011. Cultivable microbial communities in raw cow milk and potential transfers from stables of sixteen French farms. Int J Food Microbiol 146(3): 253-262.
• VAUTOR E, ABADIE G, GUIBERT JM, HUARD C & PÉPIN M. 2003. Genotyping of Staphylococcus aureus isolated from various sites on farms with dairy sheep using pulsed-field gel electrophoresis. Vet Microbiol 96(1): 69-79.
• WANG Y & QIAN Y. 2009. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies. PLoS ONE 4(10): e7401.
• WANG Y, WU J, MENGXIN LV, SHAO Z, HUNGWE M, WANG J & GENG W. 2021. Metabolism Characteristics of Lactic Acid Bacteria and the Expanding Applications in Food Industry. Front Bioeng Biotechnol 9.
• WESTALL S & FILTENBORG O. 1998. Spoilage yeasts of decorated soft cheese packed in modified atmosphere. Food Microbiol 15(2): 243-249.
• WHITE TJ, BRUNS T, LEE SJWT & TAYLOR J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: Guide Meth Appl 18(1): 315-322.
• WICKHAM H. 2009. Getting started with qplot. In: Wickham H (Ed), ggplot2: Elegant Graphics for Data Analysis. Use R. New York, NY: Springer, p. 9-26.
• WIDYASTUTI Y & FEBRISIANTOSA A. 2014. The role of lactic acid bacteria in milk fermentation. Food Nutr Sci 5(4): 720-726.
• YELURI JONNALA BR, MCSWEENEY PL, SHEEHAN JJ & COTTER P D. 2018. Sequencing of the Cheese Microbiome and Its Relevance to Industry. Front Microbiol 9.
• ZAHEER R, COOK SR, BARBIERI R, GOJI N, CAMERON A, PETKAU A & MCALLISTER TA. 2020. Surveillance of Enterococcus spp. reveals distinct species and antimicrobial resistance diversity across a One-Health continuum. Sci Rep 10: 3937.

Publication Dates

• Publication in this collection
  11 July 2025
• Date of issue
  2025

History

• Received
  27 Feb 2024
• Accepted
  27 Mar 2025