Lipopolysaccharide effects on activation and apoptosis of primordial ovarian follicles in heifers

[Efeitos de lipopolissacarídeos na ativação e apoptose de folículos ovarianos primordiais em novilhas]

ABSTRACT

The objective of the present study was to evaluate the effect of lipopolysaccharide (LPS) administration on activation and apoptosis of primordial follicles. There was no difference in the total number of follicles as well as in the different types of follicles. Furthermore, the LPS challenge didn’t modulate the expression of genes related with ovarian reserve (HAM), oocyte survival (Survivin), activation rate (Pten, KIT, KITL1, KITL2, AKT1, SIRT1), and follicular abnormalities. Therefore, the LPS exposure with 24h interval had no effect on activation rate and primordial follicles abnormalities, and also had no effect on expression of anti-apoptotic genes and genes related with ovarian reserve, oocyte survival, activation rate, and primordial follicles abnormalities.

Keywords:
endotoxin; follicle; inflammation; oocyte; reproduction

RESUMO

O objetivo do presente estudo foi avaliar o efeito da administração de lipopolissacarídeo (LPS) na ativação e a apoptose de folículos primordiais. Dez novilhas saudáveis (Bos taurus taurus), com idade média de 14 meses, alojadas em sistema de confinamento e alimentadas com TMR, foram utilizadas neste experimento. Os animais foram distribuídos aleatoriamente em dois grupos: grupo LPS (LPS; n = 5), que recebeu duas injeções intravenosas de 0,5μg/kg de peso corporal de lipopolissacarídeo (Sigma Aldrich®) diluído em 2mL de solução salina (0,9% de NaCl), com intervalo de 24h; e grupo controle (CTR; n = 5), que recebeu duas injeções intravenosas de 2mL de solução salina (0,9% de NaCl), com intervalo de 24h. A primeira injeção de LPS foi realizada no d 1, e no d 5 os animais foram abatidos, os ovários foram pesados e as amostras dos ovários foram coletadas para avaliação histológica e molecular. Não houve diferença no número total de folículos, bem como nos diferentes tipos de folículos. Além disso, o desafio com LPS não modulou a expressão de genes relacionados à reserva ovariana (HAM), à sobrevivência oocitária (Survivin), à taxa de ativação (Pten, KIT, KITL1, KITL2, AKT1, SIRT1) e às anormalidades foliculares. Portanto, a exposição ao LPS com intervalo de 24h não teve efeito sobre a taxa de ativação e as anormalidades dos folículos primordiais, bem como não teve efeito sobre a expressão de genes antiapoptóticos e de genes relacionados com a reserva ovariana, a sobrevivência oocitária, a taxa de ativação e as anormalidades dos folículos primordiais.

Palavras-chave:
endotoxina; folículo; inflamação; oócito; reprodução

INTRODUCTION

The ovarian lifespan is determined by the number of oocytes at birth, as well as by the rate at which these oocytes will be depleted (Morita et al., 2000). The programmed cell death (apoptosis) is the main mechanism responsible for the age-related oocyte exhaustion and the relation between pro-survival and pro-apoptotic molecules is key for the follicles life cycle (Morita et al., 2000). Studies have shown the relation between ovarian reserve and fertility (Evans et al., 2010, 2012; Ireland et al., 2011). There is evidence that low follicular reserve is associated with impaired fertility, reducing the conception rate and increasing calving-conception interval (Evans et al., 2010;).

Bromfield and Sheldon (2013) have shown that follicle reserve quality is influenced by inflammatory and infectious events. Regarding the dairy industry, calves are often exposed to cases of diarrhea and bronchopneumonia; and adult animals are exposed to mastitis, endometritis, and acidosis (Seegers et al., 2003; Gilbert et al., 2005; Haimerl and Heuwieser, 2014; Pederzolli et al., 2018). In the beef industry, the major challenges for adult animals are bronchopneumonia and acidosis (Härtel et al., 2004; Pederzolli et al., 2018). These diseases are caused by bacteria, mainly Gram negative, which release lipopolysaccharide (LPS), one of the constituents of their outer membrane. LPS has the capacity to migrate to the blood, where it is recognized by membrane Toll-like receptor 4 (TLR4) initiating an inflammatory response with the production of cytokines (Eckel and Ametaj, 2016). Moreover, LPS can be transported to peripheral tissues such as the ovaries, inducing a localized inflammation and altering the development and endocrine function of antral follicles (Bromfield and Sheldon, 2011; Lavon et al., 2011).

It is thought that endotoxins and inflammatory processes can lead to chronic effects, since the animals present impairment of the reproduction performance up to 60-80 days after the disease occurrence (Sheldon et al., 2009; Hertl et al., 2010; Hudson et al., 2012). Bromfield and Sheldon (2013) demonstrated in an in vitro study that exposure of the bovine cortex to LPS increases the follicles’ activation rate. In this same work the authors evaluated the effects of LPS in vivo in rats, demonstrating a 3 time increase in the apoptosis of primary follicles and reduction of 1.2 times in the pool of primary follicles in animals exposed to LPS, which could lead to an early depletion of the follicular reserve.

However, there are few in vivo studies conducted in cattle to evaluate the effects of LPS on the ovarian reserve. Thus, the hypothesis of our study is that exposing cows to LPS would create a greater activation and greater apoptosis rate in primary follicles. The objective of the present study was to assess the effect of LPS in vivo on the activation and apoptosis of primordial follicles and other follicle types in cows.

MATERIALS AND METHODS

The experiment was approved by the Animal Ethics and Experimentation Committee of the Federal University of Pelotas (no. 9364). Ten healthy heifers (Bos taurus taurus), averaging 14 months old, housed in a confinement system, and fed a TMR were used in this experiment. All heifers were submitted to the same synchronization protocol. Estrous cycles were pre synchronized with administration of 25mg of prostaglandin (PGF2α) (i.m., Lutalyse®; Zoetis, São Paulo, Brasil) fourteen days prior to the synchronization protocol. On day zero (D0), heifers received a controlled internal drug-release insert impregnated with progesterone (1.9 g, CIDR®, Zoetis®), 2mg of estradiol benzoate (Gonadiol, Zoetis®) i.m., and 25mg of PGF2α (Lutalyse®, Zoetis) I.M. The CIDR was removed on D5 (Cavalieri et al., 2018). Heifers were randomly assigned into two groups: LPS group (n = 5) which received two intravenous injections of 0.5μg/kg of BW of LPS (Sigma Aldrich®) diluted in 2 mL of saline solution (0,9% de NaCl) with 24h interval; and Control group (n = 5) which received two intravenous injections of 2mL of saline solution (0.9% de NaCl) with 24h interval. LPS dose and administration interval were chosen according to the lowest dose that induced an inflammatory response in bovine previously (Waldron et al., 2003; Fernandes et al., 2019). The first LPS injection was performed on D1, and heifers were slaughtered on D5, when ovaries were weighted and samples from the ovaries were collected. For histological evaluations ovary samples were fixed in formalin. For gene expression, samples were transferred to cryogenic tubes and following homogenization in 0.5mL of trizol (Invitrogen®, Carlsbad, CA, USA) samples were stored in liquid nitrogen.

Ovaries were removed from formalin, dehydrated in alcohol solution, cleared with xylene, and embedded in Paraplast Plus® (Sigma Chemical Company®, St. Louis, MO, EUA). Embedded ovaries were then sectioned using a 5 μm microtome (RM2245, Leica Biosystems, San Diego, CA, USA) and samples were collected every 120 histological sections, with cuts being made in the entirety of the ovary, according to methodology done by Driancourt et al., 1985. Microscope slides were dried in an oven at 56°C for 24 hours and stained with hematoxylin and eosin. Subsequently, ovary images were captured at 10 x magnification by a camera attached to the microscope (Nikon Eclipse E200, Nikon Corporation, Japan) using the Motic Image Plus 2.0 software (Motic®, Hong Kong, China).

To determine the population of follicles in each category, the correction factor used was the described by (Gougeon and Chainy, 1987) in the following formula Nt= No x St x Ts ⁄ So x Do. Where Nt: Estimated total number of follicles of each category; No: Number of follicles observed in the ovary; St: Total number of cuts made in the ovary; Ts: Thickness of the cut; So: Total number of cuts observed and Do: Mean core diameter do oocyte. To determine the diameter of the core of the oocyte, a horizontal and a vertical measurement was made.

Preantral follicles were classified according to the developmental stage as primordial (one layer of flattened granulosa cells around the oocyte), transition (flattened and cuboidal granulosa cells around the oocyte), primary (one layer of cuboidal granulosa cells around the oocyte), or secondary (two or more layers of cuboidal granulosa cells around the oocyte) (Hulshof et al., 1994). Follicle degeneration was characterized by one or more of the following aspects: condensed oocyte nucleus, shrunken oocyte, pyknotic bodies in the granulosa cells, low cellular density, widespread disintegration of the granulosa cells (Driancourt et al., 1985, Silva-Santos et al., 2011). Only follicles in which the oocyte nucleus was visible in each histological section were counted, to avoid counting the same follicle repeatedly.

Total RNA from the ovarian tissue was extracted using Trizol reagent (Invitrogen®) following the manufacturer's instructions. The RNA concentration was measured with a spectrophotometer (Nanodrop Lite, Thermo Fischer Scientific Inc., USA) and purity was assessed through the ratio of absorbance at 260/280nm. Reverse transcription was conducted with 1 pg of total RNA in a reaction volume of 20µL, using a commercial kit (iScript Synthesis kit, BIORAD®, Hercules, CA, USA) following the manufacturer's instructions. A thermal cycler was used following these cycling parameters: 5°C for 5 min, 42°C for 20 min, and 95°C for 1 min.

The real-time polymerase chain reaction (PCR) was performed in a volume of 15 µL containing GoTaq reagent (GoTaq® qPCR Master Mix, Promega, Madison, WI, USA) in a thermal cycler StepOnePlus (Applied Biosystems, Foster City, CA, USA). Each reaction was performed in duplicates containing 4 µL of cDNA (20 ng), 5µL of GoTaq, 0.75µL of each primer (5µM), and 4,5µL of ultrapure water. Forty-five cycles were conducted (95°C for 15 seg and 60 °C for 1 min) and the last of each reaction was performed in a dissociation curve (Melting) to verify the amplification of a single PCR product.

The genes H2A clustered histone 6 (H2AC6), 18S ribosomal RNA (RN18S1), ubiquitously expressed prefoldin like chaperone (UXT), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as endogenous reference and the target genes associated with primordial follicles activation were phosphatase and tensin homolog (PTEN), phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1), proto-oncogene, receptor tyrosine kinase (KIT), KIT ligand (KITLG), KIT ligand 2 (KITL2), sirtuin 1 (SIRT1) AKT serine/threonine kinase 1 (AKT1) anti-Mullerian hormone (AMH), mechanistic target of mammalian target of rapamycin (MTOR), and survivin (SURVIVIN) were. The primers sequences are described in Table 1.

Table 1
Genes evaluated from ovary samples of heifers challenged or not with LPS

Gene	Primer sequence 5´ → 3´	NCBI Code	Reference
H2AC6	F: GAGGAGCTGAACAAGCTGTTG	NM_001205596.1	[55]
	R: TTGTGGTGGCTCTCAGTCTTC
RN18S1	F: CCTTCCGCGAGGATCCATTG	NR_036642.1	[56]
	R: CGCTCCCAAGATCCAACTAC
UXT	F: TGTGGCCCTTGGATGGATGGTT	NM_001037471.2	[57]
	R: GGTTGTCGCTGAGCTGAGCTG
GAPDH	F: GATTGTCAGCAATGCCTCCT	NM_001034034.2	[56]
	R: GGTCATAAGTCCCTCCACGA
KIT	F: ATCATGAAGACCTGCTGGGATGCT	NM_001166484.1	[58]
	R: GGGCTGCAGTTTGCTAAGTTGGAA
KITL1	F: GTGTGATTTCCTCAACATCAAGTCC	NM_174375.2	[58]
	R: TGCTACTGCTGTCATTCCTAAGGG
KITL2	F: AAGGGAAGGCCTCAAATTCCATTGAAGA	NM_174375.2	[58]
	R: AGCAAACCCGATCACAAGAGA
AMH	F: ACACCGGCAAGCTCCTCAT	NM_173890.1	[59]
	R: CACCATGTTTGGGACGTGG
MTOR	F: TCCTTGTCACGAGGCAACAA	XM_002694043.6	This study
	R: GGCGTATCAATTCTTGCAATGA
AKT1	F: GATTCTTCGCCAGCATCGTG	NM_173986.2	[60]
	R: GGCCGTGAACTCCTCATCAA
PTEN	F: GCCACAAAGTGCCTCGTTTACC	NM_001319898.1	[61]
	R: AGAAGGCAACTCTGCCAAACAC
SIRT1	F: CAACGGTTTCCATTCGTGTG	NM_001192980.3	[62]
	R: GTTCGAGGATCTGTGCCAAT
PIK3R1	F: ACACAGCTGACGGGACCTTT	NM_174575.1	[61]
	R: CCATATTTCCCATCTCGGTGA

The coefficient of variation was less than 5% for all the primer pairs used. Relative expression from real-time PCR was calculated from the equation 2A-B/2C-D (where A = Cycle Threshold (Ct) number for the gene of interest in the first control sample; B = Ct number for the gene of interest in the analyzed sample; C = Ct number for the housekeeping gene (geometric mean of genes H2AC6, RN18S1, UXT e GAPDH) in the first control sample; and D = Ct number for housekeeping gene in the analyzed sample). The first control was expressed as 1.00 by this equation, and all other samples were calculated in relation to this value. Afterward, the results in the control group (N-AL) were averaged, and all other outputs were divided by the mean value of the relative expression in the control group to yield the fold change of the genes of interest expression compared to the control group (Masternak et al., 2005).

Data relative to histological analysis and gene expression were analyzed with a t-test in the GraphPad Prism 7 (GraphPad Software Inc., La Jolla, CA, USA). Values of p <0.05 were considered significant. The abnormal, primordial, transition, primary follicles and total follicles did not present a normal distribution and were transformed into log10.

RESULTS

There was no difference in the total follicular population (Control: 70939±5662; LPS: 95890±35024; P = 0,78), as well as in the different follicle stages (Table 2).

Besides, the frequency of healthy follicles was 51.52% in the control group and 40.62% in the LPS group (P=0.74).

There was no difference in the expression of anti-apoptotic genes and genes related to ovarian reserve, oocyte survival, activation rate, and primordial follicles abnormalities (Figure 1; P>0,05).

Table 2
Total follicles according to phase from heifers challenged or not with LPS

Group / Phase	Control	LPS	P-value
Primordial	15872± 3.225 (15.83%)	16557± 6395 (16.07%)	0.92
Transition	23916 ± 3786 (30.92%)	21285 ± 4461 (18.05%)	0.67
Primary	4369 ± 1476 (3.70%)	6235 ± 1498 (5.53%)	0.40
Secondary	1416± 441 (1.07%)	1292 ± 406 (0.96%)	0.84
Abnormal primordial	7308 ± 1874(10.02%)	15042±6939 (18.51%)	0.31
Abnormal transition	13236± 2339 (33.30%)	22245 ± 13755 (28.12%)	0.90
Abnormal primary	3422 ± 977 (3.92%)	11067± 6426 (10.72%)	0.16
Abnormal secondary	1400 ± 206 (1.24%)	2167 ± 595 (2.01%)	0.25

Figure 1
Gene expression related to follicular activation, ovarian reserve and anti-apoptotic in heifers which were challenged with LPS or not.

DISCUSSION

The binding of pathogen-associated molecular patterns (PAMPs) or LPS to toll-like receptors (TLRs) stimulates the production of cytokines such as interleukin-1 α and β (IL1-α and β), interleukin-6 (IL6), interleukin-8 (IL-8) and tumor necrosis factor alpha (TNF-α) in the blood (Beutler, 2009; Takeuchi and Akira, 2010) and also locally in the ovary, which seem to act by increasing the rate of atresia and follicular activation (Bromfield and Sheldon, 2013; Passos et al., 2016). Based on this hypothesis, we analyzed genes involved in the process of primordial follicle activation (KIT, KITL1, KITL2, AKT1, SIRT1) and inhibition of activation (PTEN) (, Chen et al., 2020, Zhao et al., 2021), as well as a gene linked to ovarian reserve (HAM) and an anti-apoptotic gene (Survivin) (Chen et al., 2020).

In our study, the challenge with LPS did not alter the expression of genes related to abnormality and follicular activation, nor did it change the percentage of atretic follicles, and the rate of follicular activation evaluated histologically. The results of HAM expression corroborate the results found in the histological evaluation, since this hormone is secreted from granulosa cells of the ovarian follicles and has been studied as an endocrine marker capable of estimating the ovarian reserve (Ireland and Mossa, 2018).

The activation of primordial follicles is morphologically characterized by the transition from flattened to cuboidal granulosa cells, independent of gonadotropins and involved in pathways such as PI3K-AKT-mTORC (Adhikari et al., 2010; Li et al., 2010, Maidarti et al., 2020). This process requires accumulation of phosphatidylinositol-triphosphate (PIP3), which causes PI3K stimulation and promotes Akt phosphorylation, resulting in the induction of oocyte growth and meiotic maturation (Hoshino et al., 2004; Kalous et al., 2006; Wang et al., 2016). The stimulation of mTORC promotes protein synthesis, lipid and nucleotide biogenesis (Guo and Yu, 2019), and the super activation of the PI3K/Akt/mTOR signaling pathway has been linked to premature activation of primordial follicles, leading to early follicular atresia (McLaughlin and Sobinoff et al., 2011). Growth factors KIT, KITL1 and KTL2 also participate in the activation pathway, which stimulate the AKT/PI3K pathway (Jones and Pepling, 2013; Cavalcante et al., 2016. On the other hand, the PTEN protein, which is a lipid phosphatase, acts by inhibiting the activation of this pathway), by transforming PIP3 into PIP2, keeping the follicles inactive and reducing cell proliferation (Wang et al., 2016, Takeuchi et al., 2019, Maidarti et al., 2019). The specific deletion of PTEN from oocytes in the primordial stage in mice, allows the accumulation of PIP3 to occur, which triggers the global activation of all these follicles (Reddy et al., 2008).

Differently from our results, Bromfield and Sheldon (2013) have observed that an in vitro bovine ovarian cortex culture containing 10µg/mL of LPS for 6 days, induced a reduced expression of PTEN, associated with greater follicular activation. In the same study, there was a higher percentage of follicles that transitioned from primordial to the primary phase (56% higher in the group exposed to LPS when compared to the control group), also there was a greater number of follicles in the group challenged with LPS that transitioned from the primary phase to the secondary phase (17% higher).

Similarly, LPS exposure caused a reduction in follicular reserve in mice (Wu et al., 2011; Sominsky et al., 2012). Fuller et al. (2017), mice exposed to LPS 3 or 5 days after birth, generated a reduction in the number of primordial follicles in animals exposed to LPS on day 5 and a greater proportion of activated primordial follicles in both animals exposed on day 3 and day 5.

In addition to follicular activation, previous studies have shown higher occurrence of apoptosis in animals exposed to LPS. Bromfield and Sheldon (2013) have conducted an in vivo challenge with LPS in mice and have found an increase in follicular atresia, going from 3% to 9.8%, mediated by the inflammatory response, since TLR4 knockout mice did not show this increase. Follicular atresia is mediated by ligands such as TNF-α and interferon or by the mitochondrial pathway in which members of the Bcl-2 family play an important role (Hussein et al., 2003, 2005). It has been demonstrated that TNF-α can induce a decrease in the number of primordial oocytes and follicles by inducing apoptosis (Morrison, L.J.; Marcinkiewicz, J.L, 2002, Silva et al., 2020).

The difference in our results, considering studies already carried out in vitro with ovaries of cattle and mice and in vivo with mice, is probably due to the type of LPS exposure and the dose used. In in vitro studies there is constant exposure of follicles to LPS and inflammatory cytokines, and in addition, the doses used are higher than those that occur naturally, since in in vivo studies, the organism uses mechanisms to eliminate these endotoxins, such as the detoxification that occurs in the liver (Jirillo et al., 2002). The dose recommended in our study was based on previous research (Waldron et al., 2003) that showed that 0.5µg/kg can promote the activation of defense cells and a systemic response.

Moreover, bovines usually have a large individual variation in the total follicular population (Ericksson, 1966; Silva-Santos, 2011), which was also observed in our study, and it is another factor that interferes in the results. Silva-Santos (2011) has demonstrated that animals from 0 to 24 months had a variation from 0 to 700,000 germ cells. In addition, the total number of follicles remains similar until around 4-6 months, progressively decreasing after this period (Silva-Santos, 2011). This variation is already widely reported and related to the lower or higher performance of animals in reproductive biotechnology protocols (Ireland, J., Mossa, F., 2018), and several studies seek to find markers that indirectly indicate the germ cell population.

In dairy and beef cattle, exposures to bacteria are common throughout the life of the animals, and from our study we observed that acute exposures with short duration do not influence the rate of activation and follicular abnormality. However, it is worth mentioning that in infectious and metabolic conditions, exposure to these endotoxins occurs for a longer period, varying according to the beginning of the treatment. Therefore, further studies are needed to understand the damage caused by LPS and inflammatory cytokines in the bovine ovarian reserve.

CONCLUSION

The exposure of beef heifers to LPS in a 24 hour interval was not capable of altering the primordial follicles rate of activation and abnormality, as well as the expression of anti-apoptotic genes and genes related to the activation and inhibition of primordial follicles.

ACKNOWLEDGEMENTS

The authors would like to thank the Coordination for the Improvement of Higher Education Personnel (CAPES, Brasilia, Brazil) and the National Council for Scientific and Technological Development (CNPq, Brasilia, Brazil) for the financial support. Also, we would like to thank the Espinilho Slaughterhouse for providing the animals used in this study.

REFERENCES

• ADHIKARI, D.; ZHENG, W.; SHEN, Y. et al. Tsc/mTORC1 signaling in oocytes governs the quiescence and activation of primordial follicles. Hum. Mol. Genet., v.19, p.397-410, 2010.
• BEUTLER, B.A. TLRs and innate immunity. Blood, v.113, p.1399-1407, 2009.
• BROMFIELD, J.J.; SHELDON, I.M. Lipopolysaccharide initiates inflammation in bovine granulosa cells via the TLR4 pathway and perturbs oocyte meiotic progression in Vitro. Endocrinology, v.152, p.5029-5040, 2011.
• BROMFIELD, J.J.; SHELDON, I.M. Lipopolysaccharide reduces the primordial follicle pool in the bovine ovarian cortex ex vivo and in the murine ovary in vivo1. Biol. Reprod., v.88, p.98, 2013.
• CAVALCANTE, A.Y.P.; GOUVEIA, B.B.; BARBERINO, R.S. et al. Kit ligand promotes the transition from primordial to primary follicles after in vitro culture of ovine ovarian tissue. Zygote, v.24, p.578-582, 2016.
• CHEIN, Y.; YANG, W.; SHI, X. et al. The Factors and Pathways Regulating the Activation of Mammalian Primordial Follicles in vivo. Front. Cell. Dev., v.1, p.11, 2020.
• Driancourt, M. A., R. C. Fry, L. P. Cahill, and B. M. Bindon. 1985. Ovarian follicular populations and preovulatory enlargement in Booroola and control Merino ewes. J. Reprod. Fertil. 73:93.
• ECKEL, E.F.; AMETAJ, B.N. Invited review: Role of bacterial endotoxins in the etiopathogenesis of periparturient diseases of transition dairy cows. J. Dairy Sci., v.99, p.5967-5990, 2016.
• ERICKSON, B.H. Development and senescence of the postnatal bovine ovary. J. Anim. Sci., v.25, p.800-805, 1966.
• EVANS, A.; MOSSA, F.; FAIR, T. et al. Causes and consequences of the variation in the number of ovarian follicles in cattle. Reprod. Domest. Ruminants, v.7, p.419-427, 2010.
• EVANS, A.C.O.; MOSSA, F.; WALSH, S. et al. Effects of Maternal Environment During Gestation on Ovarian Folliculogenesis and Consequences for Fertility in Bovine Offspring. Reprod. Domest. Anim., v.47, Supl.4, p.31-37, 2012.
• FERNANDES, A.C.C.; DAVOODI, S.; KAUR, M. et al. Effect of repeated intravenous lipopolysaccharide infusions on systemic inflammatory response and endometrium gene expression in Holstein heifers. J. Dairy Sci., v.102, p.3531-3543, 2019.
• FULLER, E.A.; SOMINSKY, L.; SUTHERLAND, J.M. et al. et al. Neonatal immune activation depletes the ovarian follicle reserve and alters ovarian acute inflammatory mediators in neonatal rats†. Biol. Reprod., v.97, p.719-730, 2017.
• GILBERT, R.O.; SHIN, S.T.; GUARD, C.L.; ERB, H.N.; FRAJBLAT, M. Prevalence of endometritis and its effects on reproductive performance of dairy cows. Theriogenology, v.64, p.1879-1888, 2005.
• GUO, Z.; YU, Q. Role of mTOR signaling in female reproduction. Front. Endocrinol., v.10, p.692, 2019.
• GOUGEON, A.; CHAINY, G.B. Morphometric studies of small follicles in ovaries of women at fferent ages. J. Reprod. Fertil., v.81, p.433-442, 1987.
• HAIMERL, P.; HEUWIESER, W. Invited review: antibiotic treatment of metritis in dairy cows: a systematic approach. J. Dairy Sci., v.97, p.6649-6661, 2014.
• HÄRTEL, H.; NIKUNEN, S.; NEUVONEN, E. et al. Viral and bacterial pathogens in bovine respiratory disease in Finland. Acta Vet. Scand., v.45, p.193-200, 2004.
• HERTL, J.A.; GRÖHN, Y.T.; LEACH, J.D.G. et al. Effects of clinical mastitis caused by gram-positive and gram-negative bacteria and other organisms on the probability of conception in New York State Holstein dairy cows. J. Dairy Sci., v.93, p.1551-1560, 2010.
• HOSHINO, Y.; YOKOO, M.; YOSHIDA, N. et al. Phosphatidylinositol 3-kinase and Akt participate in the FSH-induced meiotic maturation of mouse oocytes. Mol. Reprod. Dev., v.69, p.77-86, 2004.
• HUDSON, C.D.; BRADLEY, A.J.; BREEN, J.E.; GREEN, M.J. Associations between udder health and reproductive performance in United Kingdom dairy cows. J. Dairy Sci., v.95, p.3683-3697, 2012.
• HULSHOF, S.C.J.; FIGUEIREDO, J.R.; BECKERS, J.F.; BEVERS, M.M.; VAN DEN HURK, R. Isolation and characterization of preantral follicles from foetal bovine ovaries. Vet. Q., v.16, p.78-80, 1994.
• HUSSEIN, M.R. Apoptosis in the ovary: molecular mechanisms. Hum. Reprod. Update, v.11, p.162-178.
• HUSSEIN, M.R.; HAEMEL, A.K.; WOOD, G.S. Apoptosis and melanoma: molecular mechanisms. J. Pathol., v.199, p.275-288, 2003.
• IRELAND, J.; MOSSA, F. 125 Anti-Müllerian Hormone (AMH): a biomarker for the ovarian reserve, ovarian function and fertility in dairy cows. J. Anim. Sci., v.96, p.343-343, 2018.
• IRELAND, J.J.; SMITH, G.W.; SCHEETZ, D. et al. Does size matter in females ? An overview of the impact of the high variation in the ovarian reserve on ovarian function and fertility , utility of anti-Mu ¨ llerian hormone as a diagnostic marker for fertility and causes of variation in the ovarian reser. Reprod. Fertil. Dev., v.23, p.1-14, 2011.
• JIRILLO, E.; CACCAVO, D.; MAGRONE, T. et al. The role of the liver in the response to LPS: Experimental and clinical findings. J. Endotoxin Res., v.8, p.319-327, 2002.
• JONES, R.L.; PEPLING, M.E. KIT signaling regulates primordial follicle formation in the neonatal mouse ovary. Dev. Biol., v.382, p.186-197, 2013.
• KALOUS, J.; SOLC, P.; BARAN, V. et al. PKB/AKT is involved in resumption of meiosis in mouse oocytes. Biol. Cell., v.98, p.111-123, 2006.
• LAVON, Y.; LEITNER, G.; KLIPPER, E. et al. Subclinical, chronic intramammary infection lowers steroid concentrations and gene expression in bovine preovulatory follicles. Domest. Anim. Endocrinol., v.40, p.98-109, 2011.
• LI, J.; KAWAMURA, K.; CHENG, Y. et al. Activation of dormant ovarian follicles to generate mature eggs. Proc. Natl. Acad. Sci., v.107, p.10280-10284, 2010.
• MAIDARTI, M.; ANDERSON, R.A.; TELFER, E.E. Crosstalk between PTEN/PI3K/Akt signaling and DNA damage in the oocyte: implications for primordial dollicle activation, oocyte quality and ageing. Cells, v.9, p.200, 2020.
• MAIDARTI, M.; CLARKSON, Y.; MCLAUGHLIN, M.; RICHARD, M.; TELFER, E. Inhibition of PTEN activates bovine non-growing follicles in vitro but increases DNA damage and reduces DNA repair response. Hum. Reprod., v.34, p.297-307, 2019.
• MASTERNAK, M.M.; AL-REGAIEY, K.A.; DEL ROSARIO LIM, M.M. et al. Caloric restriction results in decreased expression of peroxisome proliferator-activated receptor superfamily in muscle of normal and long-lived growth hormone receptor/binding protein knockout mice. J. Gerontol. A Biol. Sci. Med. Sci., v.60, p.1238-1245, 2005.
• MCLAUGHLIN, E.A.; SOBINOFF, A.P. Contraception Targets in Mammalian Ovarian Development. Handb. Exp. Pharmacol., v.198, p.45-66, 2010.
• MORITA, Y.; PEREZ, G.I.; PARIS, F. et al. Oocyte apoptosis is suppressed by disruption of the acid sphingomyelinase gene or by sphingosine -1-phosphate therapy. Nat. Med., v.6, p.1109-1114, 2000.
• MORRISON, L.J.; MARCINKIEWICZ, J.L. Tumor necrosis factor α enhances oocyte/follicle apoptosis in the neonatal rat ovary1. Biol. Reprod., v.66, p.450-457, 2002.
• PASSOS, J.R.S.; COSTA, J.J.N.; CUNHA, E.V. et al. Protein and messenger RNA expression of interleukin 1 system members in bovine ovarian follicles and effects of interleukin 1β on primordial follicle activation and survival in vitro. Domest. Anim. Endocrinol., v.54, p.48-59, 2016.
• PEDERZOLLI, R.L.A.; VAN KESSEL, A.G.; CAMPBELL, J. et al. Effect of ruminal acidosis and short-term low feed intake on indicators of gastrointestinal barrier function in Holstein steers. J. Anim. Sci., v.96, p.108-125, 2018.
• REDDY, P.; LIU, L.; ADHIKARI, D. et al. Oocyte-specific deletion of pten causes premature activation of the primordial follicle pool. Science, v.319, p.611-613, 2008.
• SEEGERS, H.; FOURICHON, C.; BEAUDEAU, F. Production effects related to mastitis and mastitis economics in dairy cattle herds. Vet. Res., v.34, p.475-491, 2003.
• SHELDON, I.M.; CRONIN, J.; GOETZE, L.; DONOFRIO, G.; SCHUBERTH, H.J. Defining postpartum uterine disease and the mechanisms of infection and immunity in the female reproductive tract in cattle1. Biol. Reprod., v.81, p.1025-1032, 2009.
• SILVA, J.; LIMA, F.E.O.; SOUZA, A.L.P.; SILVA, A.W.B. Interleukin-1β and TNF-α systems in ovarian follicles and their roles during follicular development, oocyte maturation and ovulation. Zygote, v.28, p.270-277, 2020.
• SILVA-SANTOS, K.C.; SANTOS, G.M.G.; SILOTO, L.S. et al. Estimate of the population of preantral follicles in the ovaries of Bos taurus indicus and Bos taurus taurus cattle. Theriogenology, v.76, p.1051-1057, 2011.
• SOBINOFF, A.P.; MAHONY, M.; NIXON, B.; ROMAN, S.D.; MCLAUGHLIN, E.A. Understanding the villain: DMBA-induced preantral ovotoxicity involves selective follicular destruction and primordial follicle activation through PI3K/Akt and mTOR signaling. Toxicol. Sci., v.123, p.563-575, 2011.
• SOMINSKY, L.; MEEHAN, C.L.; WALKER, A.K. et al. Neonatal immune challenge alters reproductive development in the female rat. Horm. Behav., v.62, p.345-355, 2012.
• TAKEUCHI, A.; KOGA, K.; SATAKE, E. et al. Endometriosis triggers excessive activation of primordial follicles via PI3K-PTEN-Akt-Foxo3 pathway. J. Clin. Endocrinol. Metab., v.104, p.5547-5554, 2019.
• TAKEUCHI, O.; AKIRA, S. Pattern recognition receptors and inflammation. Cell, v.140, p.805-820, 2010.
• WALDRON, M.R.; NISHIDA, T.; NONNECKE, B.J.; OVERTON, T.R. Effect of Lipopolysaccharide on Indices of Peripheral and Hepatic Metabolism in Lactating Cows. J. Dairy Sci., v.86, p.3447-3459, 2003.
• WANG, L.Q.; LIU, J.C.; CHEN, C.L. et al. Regulation of primordial follicle recruitment by cross-talk between the Notch and phosphatase and tensin homologue (PTEN)/AKT pathways. Reprod. Fertil. Dev., v.28, p.700, 2016.
• WU, X.Q.; LI, X.F.; YE, B. et al. Neonatal programming by immunological challenge: effects on ovarian function in the adult rat. Reproduction, v.141, p.241-248, 2011.
• ZHAO, Y.; FENG, H.; ZHANG, Y. et al. Current understandings of core pathways for the activation of mammalian primordial follicles. Cells, v.10, p.1491, 2021.

Publication Dates

• Publication in this collection
  02 June 2023
• Date of issue
  May-Jun 2023

History

• Received
  22 Aug 2022
• Accepted
  11 Jan 2023