Comparative cytogenetic analyses in Ancistrus species (Siluriformes: Loricariidae)

Larissa Glugoski Geize Deon Stephane Schott Marcelo R. Vicari Viviane Nogaroto Orlando Moreira-Filho About the authors

ABSTRACT

Ancistrus is a specious genus of armored catfishes that has been extensively used for cytogenetic studies in the last 17 years. A comparison of the extensive karyotypic plasticity within this genus is presented with new cytogenetic analysis for Ancistrus cf. multispinis and Ancistrus aguaboensis. This study aims to improve our understanding of chromosomal evolution associated with changes in the diploid number (2n) and the dispersion of ribosomal DNAs (rDNAs) within Ancistrus. Ancistrus cf. multispinis and A. aguaboensis exhibit 2n of 52 and 50 chromosomes, respectively. Given that A. cf. multispinis shares a 2n = 52 also found in Pterygoplichthyini, the sister group for Ancistrini, a Robertsonian (Rb) fusion event is proposed for the 2n reduction in A. aguaboensis. 5S rDNAs pseudogenes sites have already been associated with Rb fusion in Ancistrus and our analysis suggests that the 2n reduction in A. aguaboensis was triggered by double strand breaks (DSBs) and chromosomal rearrangements at 5S rDNA sites. The presence of evolutionary breakpoint regions (EBRs) into rDNA cluster is proposed to explain part of the Rb fusion in Ancistrus. Cytogenetic data presented extends the diversity already documented in Ancistrus to further understand the role of chromosomal rearrangements in the diversification of Ancistrini.

Keywords:
Armored catfish; FISH; 5S rDNA; 18S rDNA; telomeric sequence

RESUMO

Ancistrus é um gênero rico em espécies de peixes conhecidos como cascudos e tem sido alvo de estudos citogenéticos nos últimos 17 anos. Uma comparação da plasticidade presente no gênero é apresentada com novas análises citogenéticas para Ancistrus cf. multispinis e Ancistrus aguaboensis. Este estudo visa melhorar nossa compreensão da evolução cromossômica associada as alterações do número diploide (2n) e a dispersão de DNAs ribossômicos (rDNAs) em Ancistrus. Ancistrus cf. multispinis e A. aguaboensis apresentaram 2n de 52 e 50 cromossomos, respectivamente. Visto que A. cf. multispinis compartilha 2n = 52 também encontrado em Pterygoplichthyini, o grupo irmão para Ancistrini, um evento de fusão Robertsoniana (Rb) é proposto para a redução do 2n em A. aguaboensis. Sítios de pseudogenes de rDNA 5S já foram associados a eventos de fusão Rb em Ancistrus e nossas análises sugerem que a redução do 2n em A. aguaboensis foi desencadeada por quebras na dupla fita e rearranjos cromossômicos em sítios de rDNA 5S. A presença de evolutionary breakpoint regions (EBRs) em clusters de rDNA foi proposta para explicar parte da fusão Rb em Ancistrus. Os dados citogenéticos apresentados ampliam a diversidade já documentada em Ancistrus visando melhor entender o papel dos rearranjos cromossômicos na diversificação de Ancistrini.

Palavras-chave:
Cascudo; FISH; rDNA 5S; rDNA 18S; sequência telomérica

INTRODUCTION

Loricariidae is the largest family of the Siluriformes, which includes about 1.000 species distributed in the Neotropical region, and comprises fishes vulgarly called as armored catfishes (Fricke et al., 2020Fricke R, Eschmeyer WN, Fong JD. Species by subfamily/ subfamily [Internet]. San Francisco: California Academy of Science; 2020. Available from: http://researcharchive.calacademy.org/research/ichthyology/catalog/SpeciesByFamily.asp
http://researcharchive.calacademy.org/re...
). It consists of six subfamilies: Delturinae, Hypoptopomatinae, Hypostominae, Lithogeninae, Loricariinae and Rhinelepinae (Armbruster, 2004Armbruster JW. Phylogenetic relationships of the suckermouth armoured catfishes (Loricariidae) with emphasis on the Hypostominae and the Ancistrinae. Zool J Linn Soc. 2004; 141(1):1-80. https://doi.org/10.1111/j.1096-3642.2004.00109.x
https://doi.org/10.1111/j.1096-3642.2004...
; Reis et al., 2006Reis RE, Pereira EHL, Armbruster JH. Delturinae, a new loricariid catfish subfamily (Teleostei: Siluriformes), with revisions of Delterus and Hemipsilichthys. Zool J Linn Soc . 2006; 147(2):277-99. https://doi.org/10.1111/j.1096-3642.2006.00229.x
https://doi.org/10.1111/j.1096-3642.2006...
). The former subfamily Ancistrinae was considered synonymous with Hypostominae by Armbruster (2004Armbruster JW. Phylogenetic relationships of the suckermouth armoured catfishes (Loricariidae) with emphasis on the Hypostominae and the Ancistrinae. Zool J Linn Soc. 2004; 141(1):1-80. https://doi.org/10.1111/j.1096-3642.2004.00109.x
https://doi.org/10.1111/j.1096-3642.2004...
) and, currently, Hypostominae presents 483 valid species (Fricke et al., 2020Fricke R, Eschmeyer WN, Fong JD. Species by subfamily/ subfamily [Internet]. San Francisco: California Academy of Science; 2020. Available from: http://researcharchive.calacademy.org/research/ichthyology/catalog/SpeciesByFamily.asp
http://researcharchive.calacademy.org/re...
), grouped in the tribes: Corymbophanini, Rhinelepini, Hypostomini, Pterygoplichthyini and Ancistrini (Armbruster, 2004; Lujan et al., 2015Lujan NK, Armbruster JW, Lovejoy NR, López-Fernández H. Multilocus molecular phylogeny of the suckermouth armored catfishes (Siluriformes: Loricariidae) with a focus on subfamily Hypostominae. Mol Phylogenetics Evol. 2015; 82PtA:269-88. https://doi.org/10.1016/j.ympev.2014.08.020
https://doi.org/10.1016/j.ympev.2014.08....
). In a systematic review study, Ancistrini was proposed to possess ten genera considered valid (Lujan et al., 2015Lujan NK, Armbruster JW, Lovejoy NR, López-Fernández H. Multilocus molecular phylogeny of the suckermouth armored catfishes (Siluriformes: Loricariidae) with a focus on subfamily Hypostominae. Mol Phylogenetics Evol. 2015; 82PtA:269-88. https://doi.org/10.1016/j.ympev.2014.08.020
https://doi.org/10.1016/j.ympev.2014.08....
). Previously, this tribe was distributed in a larger number of genera which ones were found to be paraphyletic, and is therefore restricted to a weakly supported clade (Lujan et al., 2015Lujan NK, Armbruster JW, Lovejoy NR, López-Fernández H. Multilocus molecular phylogeny of the suckermouth armored catfishes (Siluriformes: Loricariidae) with a focus on subfamily Hypostominae. Mol Phylogenetics Evol. 2015; 82PtA:269-88. https://doi.org/10.1016/j.ympev.2014.08.020
https://doi.org/10.1016/j.ympev.2014.08....
). Currently, Ancistrini remains a clade rich in genera and with a high morphological diversity (Lujan et al., 2015Lujan NK, Armbruster JW, Lovejoy NR, López-Fernández H. Multilocus molecular phylogeny of the suckermouth armored catfishes (Siluriformes: Loricariidae) with a focus on subfamily Hypostominae. Mol Phylogenetics Evol. 2015; 82PtA:269-88. https://doi.org/10.1016/j.ympev.2014.08.020
https://doi.org/10.1016/j.ympev.2014.08....
), which presents constant systematic reformulations and with a lot of undescribed species waiting for scientific validation.

Pterygoplichthyini was considered sister group for Ancistrini (Ambruster, 2004Armbruster JW. Phylogenetic relationships of the suckermouth armoured catfishes (Loricariidae) with emphasis on the Hypostominae and the Ancistrinae. Zool J Linn Soc. 2004; 141(1):1-80. https://doi.org/10.1111/j.1096-3642.2004.00109.x
https://doi.org/10.1111/j.1096-3642.2004...
) and cytogenetic data demonstrated 2n of 52 chromosomes in Pterygoplichthyini species (Alves et al., 2006Alves AL, Oliveira C, Nirchio M, Granado A, Foresti F. Karyotypic relationship among the tribes of Hypostominae (Siluriformes: Loricariidae) with description of X0 sex chromosome system in a Neotropical fish species. Genetica. 2006; 128(1-3):1-9. https://doi.org/10.1007/s10709-005-0715-1
https://doi.org/10.1007/s10709-005-0715-...
). Previous cytogenetic studies in Ancistrini also showed a large number of species with 2n = 52 chromosomes, predominantly of meta and submetacentric chromosomes (Artoni, Bertollo, 2001Artoni RF, Bertollo LAC. Trends in the Karyotype Evolution of Loricariidae Fish (Siluriformes). Hereditas. 2001; 134(3):201-10. https://doi.org/10.1111/j.1601-5223.2001.00201.x
https://doi.org/10.1111/j.1601-5223.2001...
; de Oliveira et al., 2006de Oliveira RR, Souza IL, Venere PC. Karyotype description of three species of Loricariidae (Siluriformes) and occurrence of the ZZ/ZW sexual system in Hemiancistrus spilomma Cardoso & Lucinda, 2003. Neotrop Ichthyol . 2006; 4(1):93- 97. https://doi.org/10.1590/S1679-62252006000100010
https://doi.org/10.1590/S1679-6225200600...
). Based on phylogenetic relationships of Hypostominae proposed by Lujan et al. (2015Lujan NK, Armbruster JW, Lovejoy NR, López-Fernández H. Multilocus molecular phylogeny of the suckermouth armored catfishes (Siluriformes: Loricariidae) with a focus on subfamily Hypostominae. Mol Phylogenetics Evol. 2015; 82PtA:269-88. https://doi.org/10.1016/j.ympev.2014.08.020
https://doi.org/10.1016/j.ympev.2014.08....
), and considering the presence of 2n = 52 chromosomes in Pterygoplichthyini, the sister group for Ancistrini, Bueno et al. (2018Bueno V, Konerat JT, Zawadzki CH, Venere PC, Blanco DR, Margarido VP. Divergent chromosome evolution in Hypostominae Tribes (Siluriformes: Loricariidae): correlation of chromosomal data with morphological and molecular phylogenies. Zebrafish. 2018; 15(5):492-503. https://doi.org/10.1089/zeb.2018.1612
https://doi.org/10.1089/zeb.2018.1612...
) suggested that the putatively ancestral condition for Ancistrini is a diploid number of 52 chromosomes, from which chromosomal diversification occurred to explain the observed karyoptypic plasticity among studied species.

Ancistrus is the specious genus of Ancistrini and is widely distributed in South America (Ferraris, 2007Ferraris CJ Jr. Checklist of catfishes, recent and fossil (Osteichthyes: Siluriformes), and catalogue of Siluriform primary types. Zootaxa. 2007; 1418:1-628. http://dx.doi.org/10.11646/zootaxa.1418.1.1
http://dx.doi.org/10.11646/zootaxa.1418....
; Armbruster, 2008Armbruster JW. The genus Peckoltia with the description of two new species and a reanalysis of the phylogeny of the genera of the Hypostominae (Siluriformes: Loricariidae). Zootaxa. 2008; 1822:1-76. https://doi.org/10.11646/zootaxa.1822.1.1
https://doi.org/10.11646/zootaxa.1822.1....
; Lujan et al., 2013Lujan NK, Roach KA, Jacobsen D, Winemiller KO, Vargas VM, Ching VR, Maestre JA. Aquatic community structure across an Andes-to-Amazon fluvial gradient. J Biogeogr. 2013; 40(9):1715-28. https://doi.org/10.1111/jbi.12131
https://doi.org/10.1111/jbi.12131...
). In this tribe, only Ancistrus species presents a diversified condition from 2n = 52 chromosomes, with a higher frequency of acrocentric chromosomes (de Oliveira et al., 2007de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Karyotype characterization and ZZ/ZW sex chromosome heteromorphism in two species of the catfish genus Ancistrus Kner, 1854 (Siluriformes: Loricariidae) from the Amazon basin. Neotrop Ichthyol . 2007; 5(3):301-06. https://doi.org/10.1590/S1679-62252007000300010
https://doi.org/10.1590/S1679-6225200700...
, 2008de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Occurrence of multiple sexual chromosomes (XX/XY1Y2 and Z1Z1Z2Z2/Z1Z2W1W2) in catfishes of the genus Ancistrus (Siluriformes: Loricariidae) from the Amazon basin. Genetica . 2008; 134(2):243-49. https://doi.org/10.1007/s10709-007-9231-9
https://doi.org/10.1007/s10709-007-9231-...
, 2009de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Mechanisms of chromosomal evolution and its possible relation to natural history characteristics in Ancistrus catfishes (Siluriformes: Loricariidae). J Fish Biol . 2009; 75(9):2209-25. https://doi.org/10.1111/j.1095-8649.2009.02450.x
https://doi.org/10.1111/j.1095-8649.2009...
; Mariotto et al., 2009Mariotto S, Centofante L, Miyazawa CS, Bertollo LAC, Moreira-Filho O. Chromosome polymorphism in Ancistrus cuiabae Knaack, 1999 (Siluriformes: Loricariidae: Ancistrini). Neotrop Ichthyol . 2009; 7(4):595-600. https://doi.org/10.1590/S1679-62252009000400006
https://doi.org/10.1590/S1679-6225200900...
, 2011Mariotto S, Centofante L, Vicari MR, Artoni RF, Moreira-Filho O. Chromosomal diversification in ribosomal DNA sites in Ancistrus Kner, 1854 (Loricariidae, Ancistrini) from three hydrographic basins of Mato Grosso, Brazil. Comp Cytogenet. 2011; 5(4):289-300. https://doi.org/10.3897/CompCytogen.v5i4.1757
https://doi.org/10.3897/CompCytogen.v5i4...
; Konerat et al., 2015Konerat JT, Bueno V, Margarido VP, Portela-Castro, ALB, Martins-Santos IC. Diversity of Sex Chromosome Systems in Ancistrini (Loricariidae, Hypostominae): ZZ/ZW in Ancistrus taunayi Miranda Ribeiro, 1918. Cytogenet Genome Res. 2015; 146(4):306-10. https://doi.org/10.1159/000441431
https://doi.org/10.1159/000441431...
; Favarato et al., 2016Favarato RM, Silva M, Oliveira RR, Artoni RF, Feldberg E, Matoso DA. Cytogenetic diversity and the evolutionary dynamics of rDNA genes and telomeric sequences in the Ancistrus genus (Loricariidae: Ancistrini). Zebrafish . 2016; 13(2):103-11. https://doi.org/10.1089/zeb.2015.1140
https://doi.org/10.1089/zeb.2015.1140...
; Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
; Bueno et al., 2018Bueno V, Konerat JT, Zawadzki CH, Venere PC, Blanco DR, Margarido VP. Divergent chromosome evolution in Hypostominae Tribes (Siluriformes: Loricariidae): correlation of chromosomal data with morphological and molecular phylogenies. Zebrafish. 2018; 15(5):492-503. https://doi.org/10.1089/zeb.2018.1612
https://doi.org/10.1089/zeb.2018.1612...
). Cytogenetic data in Ancistrus revealed a diversity of 2n and karyotype formulas (details of available Ancistrus cytogenetic data can be found in Tab. 1), which range from 2n = 34 to 54 chromosomes (Mariotto et al., 2011Mariotto S, Centofante L, Vicari MR, Artoni RF, Moreira-Filho O. Chromosomal diversification in ribosomal DNA sites in Ancistrus Kner, 1854 (Loricariidae, Ancistrini) from three hydrographic basins of Mato Grosso, Brazil. Comp Cytogenet. 2011; 5(4):289-300. https://doi.org/10.3897/CompCytogen.v5i4.1757
https://doi.org/10.3897/CompCytogen.v5i4...
). In addition, different heteromorphic sex chromosome systems are found in the genus, such as: XX/X0, XX/XY, XX/XY1Y2, ZZ/ZW and Z1Z1Z2Z2/ Z1Z2W1W2. In Ancistrus, with the exception of species with 2n = 52 and 54 chromosomes, it was suggested a reduction in 2n via Rb fusion events (de Oliveira et al., 2007de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Karyotype characterization and ZZ/ZW sex chromosome heteromorphism in two species of the catfish genus Ancistrus Kner, 1854 (Siluriformes: Loricariidae) from the Amazon basin. Neotrop Ichthyol . 2007; 5(3):301-06. https://doi.org/10.1590/S1679-62252007000300010
https://doi.org/10.1590/S1679-6225200700...
, 2008de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Occurrence of multiple sexual chromosomes (XX/XY1Y2 and Z1Z1Z2Z2/Z1Z2W1W2) in catfishes of the genus Ancistrus (Siluriformes: Loricariidae) from the Amazon basin. Genetica . 2008; 134(2):243-49. https://doi.org/10.1007/s10709-007-9231-9
https://doi.org/10.1007/s10709-007-9231-...
, 2009de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Mechanisms of chromosomal evolution and its possible relation to natural history characteristics in Ancistrus catfishes (Siluriformes: Loricariidae). J Fish Biol . 2009; 75(9):2209-25. https://doi.org/10.1111/j.1095-8649.2009.02450.x
https://doi.org/10.1111/j.1095-8649.2009...
; Mariotto et al., 2009Mariotto S, Miyazawa CS. Ancistrus cf. dubius (Siluriformes: Ancistrinae), a complex of species. 1. Chromosomal characterization of four populations and occurrence of sex chromosomes of the type XX/XY, in the Pantanal Basin of Mato Grosso, Brazil. Caryologia . 2006; 59(4):299-304. https://doi.org/10.1080/00087114.2006.10797929
https://doi.org/10.1080/00087114.2006.10...
, 2011Mariotto S, Centofante L, Miyazawa CS, Bertollo LAC, Moreira-Filho O. Chromosome polymorphism in Ancistrus cuiabae Knaack, 1999 (Siluriformes: Loricariidae: Ancistrini). Neotrop Ichthyol . 2009; 7(4):595-600. https://doi.org/10.1590/S1679-62252009000400006
https://doi.org/10.1590/S1679-6225200900...
; Konerat et al., 2015Konerat JT, Bueno V, Margarido VP, Portela-Castro, ALB, Martins-Santos IC. Diversity of Sex Chromosome Systems in Ancistrini (Loricariidae, Hypostominae): ZZ/ZW in Ancistrus taunayi Miranda Ribeiro, 1918. Cytogenet Genome Res. 2015; 146(4):306-10. https://doi.org/10.1159/000441431
https://doi.org/10.1159/000441431...
; Favarato et al., 2016Favarato RM, Silva M, Oliveira RR, Artoni RF, Feldberg E, Matoso DA. Cytogenetic diversity and the evolutionary dynamics of rDNA genes and telomeric sequences in the Ancistrus genus (Loricariidae: Ancistrini). Zebrafish . 2016; 13(2):103-11. https://doi.org/10.1089/zeb.2015.1140
https://doi.org/10.1089/zeb.2015.1140...
; Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
) and structural chromosomal changes, such as inversions, translocations, deletions and duplications (Mariotto et al., 2011Mariotto S, Centofante L, Miyazawa CS, Bertollo LAC, Moreira-Filho O. Chromosome polymorphism in Ancistrus cuiabae Knaack, 1999 (Siluriformes: Loricariidae: Ancistrini). Neotrop Ichthyol . 2009; 7(4):595-600. https://doi.org/10.1590/S1679-62252009000400006
https://doi.org/10.1590/S1679-6225200900...
).

TABLE 1
| Review of available Ancistrus cytogenetic data. “Unknown” means that the data was not available in the original manuscript. NOR: Nucleolar Organizer Region; m: metacentric; sm: submetacentric; st: subtelocentric; a: acrocentric; FN: Fundamental number. *one member of the homologous pairs with FISH markers.

In addition to Ancistrus, other members of Loricariidae present species with 2n reduction via Rb fusions, when vestiges of interstitial telomeric sites (ITS) can be visualized in some karyotypes (Rosa et al., 2012Rosa KO, Ziemniczak K, Barros AV, Nogaroto V, Almeida MC, Cestari MM, Artoni RF, Vicari MR. Numeric and structural chromosome polymorphism in Rineloricaria lima (Siluriformes: Loricariidae): fusion points carrying 5S rDNA or telomere sequence vestiges. Rev Fish Biol Fish . 2012; 22:739-49. https://doi.org/10.1007/s11160-011-9250-6
https://doi.org/10.1007/s11160-011-9250-...
; Errero-Porto et al., 2014Errero-Porto F, Vieira MMR, Barbosa LM, Borin-Carvalho LA, Vicari MR, Portela-Castro ALB, Martins-Santos IC. Chromosomal Polymorphism in Rineloricaria Lanceolata Günther, 1868 (Loricariidae: Loricariinae) of the Paraguay Basin (Mato Grosso do Sul, Brazil): Evidence of Fusions and Their Consequences in the Population. Zebrafish . 2014; 11(4):318-24. https://doi.org/10.1089/zeb.2014.0996
https://doi.org/10.1089/zeb.2014.0996...
; Favarato et al., 2016Favarato RM, Silva M, Oliveira RR, Artoni RF, Feldberg E, Matoso DA. Cytogenetic diversity and the evolutionary dynamics of rDNA genes and telomeric sequences in the Ancistrus genus (Loricariidae: Ancistrini). Zebrafish . 2016; 13(2):103-11. https://doi.org/10.1089/zeb.2015.1140
https://doi.org/10.1089/zeb.2015.1140...
; Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
; Primo et al., 2017Primo CC, Glugoski L, Almeida MC, Zawadzki HC, Moreira-Filho O, Vicari MR, Nogaroto V. Mechanisms of chromosomal diversification in species of Rineloricaria (Actinopterygii: Siluriformes: Loricariidae). Zebrafish . 2017; 14(2):161-68. https://doi.org/10.1089/zeb.2016.1386
https://doi.org/10.1089/zeb.2016.1386...
; Glugoski et al., 2018Glugoski L, Giuliano-Caetano L, Moreira-Filho O, Vicari MR, Nogaroto V. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish. Gene. 2018; 650:49-54. https://doi.org/10.1016/j.gene.2018.01.099
https://doi.org/10.1016/j.gene.2018.01.0...
). Some of these Rb events were associated with the presence of EBRs inside 5S and 45S rDNAs sites, which triggered breaks and chromosomal reorganizations (Rosa et al., 2012Rosa KO, Ziemniczak K, Barros AV, Nogaroto V, Almeida MC, Cestari MM, Artoni RF, Vicari MR. Numeric and structural chromosome polymorphism in Rineloricaria lima (Siluriformes: Loricariidae): fusion points carrying 5S rDNA or telomere sequence vestiges. Rev Fish Biol Fish . 2012; 22:739-49. https://doi.org/10.1007/s11160-011-9250-6
https://doi.org/10.1007/s11160-011-9250-...
; Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
; Primo et al., 2017Primo CC, Glugoski L, Almeida MC, Zawadzki HC, Moreira-Filho O, Vicari MR, Nogaroto V. Mechanisms of chromosomal diversification in species of Rineloricaria (Actinopterygii: Siluriformes: Loricariidae). Zebrafish . 2017; 14(2):161-68. https://doi.org/10.1089/zeb.2016.1386
https://doi.org/10.1089/zeb.2016.1386...
; Glugoski et al., 2018Glugoski L, Giuliano-Caetano L, Moreira-Filho O, Vicari MR, Nogaroto V. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish. Gene. 2018; 650:49-54. https://doi.org/10.1016/j.gene.2018.01.099
https://doi.org/10.1016/j.gene.2018.01.0...
). However, the presence of other repetitive DNA sequences, able of explaining the occurrence of other EBRs in the Loricariidae genomes, still remain uncertain (Primo et al., 2018Primo CC, Glugoski L, Vicari MR, Nogaroto V. Chromosome Mapping and Molecular Characterization of the Tc1/Mariner Element in Rineloricaria (Siluriformes: Loricariidae). Braz Arch Biol Technol . 2018; 61:e18170623. https://doi.org/10.1590/1678-4324-2018170623
https://doi.org/10.1590/1678-4324-201817...
).

Repetitive DNAs are organized as grouped blocks (microsatellites, mini-satellites, satellites and multigene families) or are dispersed (transposons and retrotransposons) on the chromosomes (Charlesworth, 1994Charlesworth B, Snegowski P, Stephan W. The evolutionary dynamics of repetitive DNA in eukaryotes. Nature. 1994; 371(6494):215-20. https://doi.org/10.1038/371215a0
https://doi.org/10.1038/371215a0...
). These repetitive sequences have been shown to be fundamental in studies related to genomic evolution (Maxon et al., 1983Maxon R, Cohn R, Kedes L, Mohun T. Expression and organization of histone genes. Annu Rev Genet. 1983; 17:239-77. https://doi.org/10.1146/annurev.ge.17.120183.001323
https://doi.org/10.1146/annurev.ge.17.12...
; Charlesworth et al., 1994Charlesworth B, Snegowski P, Stephan W. The evolutionary dynamics of repetitive DNA in eukaryotes. Nature. 1994; 371(6494):215-20. https://doi.org/10.1038/371215a0
https://doi.org/10.1038/371215a0...
; Vicari et al., 2010Vicari MR, Nogaroto V, Noleto RB, Cestari, MM, Cioffi MB, Almeida MC, Moreira-Filho O, Bertollo LAC, Artoni RF. Satellite DNA and chromosomes in Neotropical fishes: Methods, applications and perspectives. J Fish Biol . 2010; 76(5):1094-116. https://doi.org/10.1111/j.1095-8649.2010.02564.x
https://doi.org/10.1111/j.1095-8649.2010...
). Multigene families of rRNAs are composed of repetitions organized in tandem (Long, Dawid, 1980Long EO, Dawid IB. Repeated genes in eukaryotes. Annu Rev Biochem. 1980; 49:727-64. https://doi.org/10.1146/annurev.bi.49.070180.003455
https://doi.org/10.1146/annurev.bi.49.07...
). They constitute two gene families with different loci in the karyotypes: the major rDNA 45S comprises the genes that encode the 18S, 5.8S and 28S rRNAs; while the minor rDNA codifies the 5S rRNA (Long, Dawid, 1980Long EO, Dawid IB. Repeated genes in eukaryotes. Annu Rev Biochem. 1980; 49:727-64. https://doi.org/10.1146/annurev.bi.49.070180.003455
https://doi.org/10.1146/annurev.bi.49.07...
). In situ localization of rDNA sites showed that the dispersion and distribution of these repetitive DNAs may have contributed to genomic diversification and chromosomal remodeling among armored catfish (Rosa et al., 2012Rosa KO, Ziemniczak K, Barros AV, Nogaroto V, Almeida MC, Cestari MM, Artoni RF, Vicari MR. Numeric and structural chromosome polymorphism in Rineloricaria lima (Siluriformes: Loricariidae): fusion points carrying 5S rDNA or telomere sequence vestiges. Rev Fish Biol Fish . 2012; 22:739-49. https://doi.org/10.1007/s11160-011-9250-6
https://doi.org/10.1007/s11160-011-9250-...
; Errero-Porto et al., 2014Errero-Porto F, Vieira MMR, Barbosa LM, Borin-Carvalho LA, Vicari MR, Portela-Castro ALB, Martins-Santos IC. Chromosomal Polymorphism in Rineloricaria Lanceolata Günther, 1868 (Loricariidae: Loricariinae) of the Paraguay Basin (Mato Grosso do Sul, Brazil): Evidence of Fusions and Their Consequences in the Population. Zebrafish . 2014; 11(4):318-24. https://doi.org/10.1089/zeb.2014.0996
https://doi.org/10.1089/zeb.2014.0996...
; Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
; Primo et al., 2017Primo CC, Glugoski L, Almeida MC, Zawadzki HC, Moreira-Filho O, Vicari MR, Nogaroto V. Mechanisms of chromosomal diversification in species of Rineloricaria (Actinopterygii: Siluriformes: Loricariidae). Zebrafish . 2017; 14(2):161-68. https://doi.org/10.1089/zeb.2016.1386
https://doi.org/10.1089/zeb.2016.1386...
; Glugoski et al., 2018Glugoski L, Giuliano-Caetano L, Moreira-Filho O, Vicari MR, Nogaroto V. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish. Gene. 2018; 650:49-54. https://doi.org/10.1016/j.gene.2018.01.099
https://doi.org/10.1016/j.gene.2018.01.0...
).

Cytogenetic studies contribute to taxonomy by demonstrating difference in karyotypes of cryptic species (Vicari et al., 2006Vicari MR, Almeida MC, Bertollo LAC, Moreira-Filho O, Artoni RF. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA in the fish Prochilodus lineatus (Characiformes, Prochilodontidae). Genet Mol Biol . 2006; 29:621-25. https://doi.org/10.1590/S1415-47572006000400008
https://doi.org/10.1590/S1415-4757200600...
; Oliveira et al., 2016Oliveira MLM, Utsunomia R, Pansonato-Alves JC, Scacchetti PC, Primo CC, Vicari MR, Artoni RF, Centofante L, Moreira-Filho O, Oliveira C, Foresti F. Microstructural chromosome reorganization in the genus Trichomycterus (Siluriformes: Trichomycteridae). Neotrop Ichthyol . 2016; 14(2):e150084. https://doi.org/10.1590/1982-0224-20150084
https://doi.org/10.1590/1982-0224-201500...
; Barbosa et al., 2017Barbosa P, Pucci MB, Nogaroto V, Almeida MC, Artoni RF, Vicari MR. Karyotype analysis of three species of Corydoras (Siluriformes: Callichthyidae) from southern Brazil: rearranged karyotypes and cytotaxonomy. Neotrop Ichthyol. 2017; 15(1):e160056. https://doi.org/10.1590/1982-0224-20160056
https://doi.org/10.1590/1982-0224-201600...
; Nascimento et al., 2018Nascimento VD, Coelho KA, Nogaroto V, Almeida RB, Ziemniczak K, Centofante L, Pavanelli CS, Torres RA, Moreira-Filho O, Vicari MR. Do multiple karyomorphs and population genetics of freshwater darter characines (Apareiodon affinis) indicate chromosomal speciation? Zool Anz. 2018; 272:93-103. https://doi.org/10.1016/j.jcz.2017.12.006
https://doi.org/10.1016/j.jcz.2017.12.00...
) or by detecting synonym species (Bellafronte et al., 2005Bellafronte E, Margarido VP, Moreira-Filho O. Cytotaxonomy of Parodon nasus and Parodon tortuosus (Pisces, Characiformes). A case of synonymy confirmed by cytogenetic analyses. Genet Mol Biol. 2005; 28(4):710-16. https://doi.org/10.1590/S1415-47572005000500010
https://doi.org/10.1590/S1415-4757200500...
). Given the morphological similarity present in some members of Ancistrus and the occurrence of a lot of scientific undescribed species in the scientific literature, the taxonomy of the group has been suffered numerous reformulations (de Oliveira et al., 2009de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Mechanisms of chromosomal evolution and its possible relation to natural history characteristics in Ancistrus catfishes (Siluriformes: Loricariidae). J Fish Biol . 2009; 75(9):2209-25. https://doi.org/10.1111/j.1095-8649.2009.02450.x
https://doi.org/10.1111/j.1095-8649.2009...
; Lujan et al., 2015Lujan NK, Armbruster JW, Lovejoy NR, López-Fernández H. Multilocus molecular phylogeny of the suckermouth armored catfishes (Siluriformes: Loricariidae) with a focus on subfamily Hypostominae. Mol Phylogenetics Evol. 2015; 82PtA:269-88. https://doi.org/10.1016/j.ympev.2014.08.020
https://doi.org/10.1016/j.ympev.2014.08....
). In this study, the cytogenetic data of two species of Ancistrus were described and compared in order to add information to understand the chromosomal evolution in the genus and contribute to taxonomic and systematic aspects.

MATERIAL AND METHODS

Species analyzed. Twenty five specimens (13 males and 12 females) of Ancistrus cf. multispinis (Regan, 1912) from Ribeirão Grande river, Paraíba do Sul basin (Pindamonhangaba-SP, 22°47’8” S and 45°27”19” W) and 20 specimens (10 males and 10 females) of Ancistrus aguaboensis Fisch-Muller, Mazzoni, Weber, 2001 from Bandeirinha river, Tocantins basin (Formosa-GO, 15°19’25” S and 47°25’26” W) were cytogenetically analyzed. Specimens were deposited in the Coleção Ictiológica do Núcleo de Pesquisas em Limnologia, Ictiologia e Aquicultura (Nupélia) of the Universidade Estadual de Maringá, Maringá, Brazil (voucher numbers: Ancistrus aguaboensis, NUP 22305; Ancistrus cf. multispinis, NUP 22308).

Conventional cytogenetic procedures. The chromosomes were obtained from the air-drying method according to Bertollo et al. (2015Bertollo LAC, Cioffi MB, Moreira-Filho O. Direct chromosome preparation from freshwater teleost fishes. In: Ozouf-Costaz C, Pisano E, Foresti F, Almeida Toledo LF, editors. Fish cytogenetic techniques (Ray-Fin Fishes and Chondrichthyans). Enfield USA: CRC Press; 2015. p.21-26. https://doi.org/10.1201/b18534-4
https://doi.org/10.1201/b18534-4...
). Detection of the constitutive heterochromatin was performed by C-banding according to Sumner (1972Sumner AT. A simple technique for demonstrating centromeric heterochromatin. Exp Cell Res. 1972; 75(1):304-06. https://doi.org/10.1016/0014-4827(72)90558-7
https://doi.org/10.1016/0014-4827(72)905...
) and the nucleolar organizer regions (NORs) were detected by silver nitrate staining (Howell, Black, 1980Howell WM, Black DA. Controlled silver-staining of nucleolus organizer regions with a protective colloidal developer: a 1-step method. Experientia. 1980; 36(8):1014-15. https://doi.org/10.1007/bf01953855
https://doi.org/10.1007/bf01953855...
). For karyotype assembly, homologs chromosomes were paired and grouped into metacentric (m), submetacentric (sm), subtelocentric (st) and acrocentric (a), according to Levan et al. (1964Levan A, Fredga K, Sandberg AA. Nomenclature for centromeric position on chromosomes. Hereditas . 1964; 52(2):201-20. https://doi.org/10.1111/j.1601-5223.1964.tb01953.x
https://doi.org/10.1111/j.1601-5223.1964...
). To establish the fundamental number (FN), we considered the m, sm and st chromosomes as two arms, and acrocentric chromosomes were considered as a single arm. About 30 cells with chromosomes in metaphase were analyzed for each species/method.

DNA extraction and isolation of repetitive DNAs. Genomic DNA was extracted from liver using Phenol-Chloroform method (Sambrook et al., 2001Sambrook J, Russell DW. Molecular cloning, a laboratory manual. New York: Cold Spring Harbor Laboratory Press; 2001.). Genomic DNA of both species was used as template in Polymerase Chain Reactions (PCRs) to obtain 5S rDNA sequences, using the following primers: 5Sa (5’- TACGCCCGATCTCGTCCGATC -3’) and 5Sb (5’- CAGGCTGGTATGGCCGTAAGC -3’) (Martins et al., 1999Martins C, Galetti PM Jr. Chromosomal localization of 5S rDNA genes in Leporinus Fish (Anostomidae, Characiformes). Chromosome Res. 1999; 7(5):363-67. https://doi.org/10.1023/a:1009216030316
https://doi.org/10.1023/a:1009216030316...
). The amplification reaction followed Barros et al. (2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
) protocol. Agarose gel electrophoresis evidenced DNA fragments of approximately 1200 bp, which were isolated (“PCR DNA and Gel Band Purification Kit” - GE Healthcare) and cloned (“InsTAclone PCR Cloning Kit” - Promega), following the manufacturers’ instructions. The 5S rDNA clones were sequenced (ABI-Prism 3500 Genetic Analyzer - Applied Biosystems). The obtained sequences were analyzed by BIOEDIT 5.0.9 (Hall, 1999Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. 1999; 41:95-98. https://doi.org/10.14601/Phytopathol_Mediterr-14998u1.29
https://doi.org/10.14601/Phytopathol_Med...
), then submitted to an identity analysis on BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi), Rfam (https://rfam.xfam.org/) and CENSOR (www.girinst.org/censor/index.php).

Fluorescence in situ hybridization (FISH). The FISH procedures were performed following Pinkel et al. (1986Pinkel D, Straume T, Gray JW. Cytogenetic analysis using quantitative, high-sensitivity, fluorescence hybridization. Proc Natl Acad Sci USA . 1986; 83(9):2934-38. https://doi.org/10.1073/pnas.83.9.2934
https://doi.org/10.1073/pnas.83.9.2934...
) protocol, with stringency ~77% (2.5 ng/μL probe, 50% formamide, 2x SSC, 10% dextran sulfate, at 37 °C for 16 h). It was used the following probes: 18S rDNA (Hatanaka, Galetti Junior, 2004Hatanaka T, Galetti PM Jr. Mapping of the 18S and 5S ribosomal RNA genes in the fish Prochilodus argenteus Agassiz, 1829 (Characiformes, Prochilodontidae). Genetica . 2004; 122(3): 239-44. https://doi.org/10.1007/s10709-004-2039-y
https://doi.org/10.1007/s10709-004-2039-...
), 5S rDNA (1200 bp DNA fragment amplified by PCR) and the general telomeric sequence of vertebrates (TTAGGG)n (Ijdo et al., 1991Ijdo JW, Wells RA, Baldini A, Reeders ST. Improved telomere detection using a telomere repeat probe (TTAGGG)n generated by PCR. Nucleic Acids Res. 1991; 19(17):4780. https://doi.org/10.1093/nar/19.17.4780
https://doi.org/10.1093/nar/19.17.4780...
). The probes 5S rDNA and (TTAGGG)n were labeled by PCR using digoxigenin 11-dUTP (Jena Bioscience); 18S rDNA probe was labeled with biotin through the nick translation technique (“Biotin16 NT Labeling Kit” - Jena Bioscience). For signal detection, the antibodies Streptavidin Alexa Fluor 488 (Molecular Probes) and antidigoxigenin-rhodamine (Roche Applied Science) were applied. Chromosomes were counterstained with 4′,6-diamidino-2-phenylindole (DAPI 0.2 μgmL−1) in mounting medium Vectashield (Vector) and analyzed under an epifluorescence microscope Olympus BX51, coupled to the Olympus DP-72 camera with the DP2-BSW software. The best images were photographed, and karyotypes edited using Adobe Photoshop CS6.

RESULTS

Karyotypic description. Ancistrus aguaboensis presented 2n = 50 chromosomes, a karyotype formula arranged in 16m+10sm+4st+20a, FN = 80 and, without sex chromosome heteromorphism (Fig. 1A). C-banding revealed blocks of constitutive heterochromatin located on the centromeric and terminal regions of all chromosomes, in addition to one block on the pericentromeric region for the pair m2, on the interstitial long arm of the sm 9 and a large block on the terminal region of one member of the chromosome pair 18 (Fig. 1B). NORs sites were located on the short arms of acrocentric pair 25 (Fig. 1B, box).

FIGURE 1
| Karyotypes of Ancistrus aguaboensis (A-B) and Ancistrus cf. multispinis (C-D) submitted do Giemsa staining (A-C) and C-banding (B-D). The chromosomes pairs with NORs sites are evidenced in the figure details (boxes). Bar = 10 µm.

Ancistrus cf. multispinis presented 2n = 52 chromosomes, a karyotype formula arranged in 16m+10sm+6st+20a, FN=84 and, no heteromorphism of sex chromosomes was detected (Fig. 1C). The heterochromatin bands were located on the subterminal regions of the short arms of chromosomes pairs 1, 2, 3 and 10; in addition to blocks of heterochromatin on the subterminal regions of the long arms of chromosomes pairs 13, 17, 18 and 20, on the interstitial region of chromosome pair 23, and on one member of each homologs chromosome pairs 25 and 26 (Fig. 1D). NORs sites were visualized on the short arms of the acrocentric pair 24 (Fig. 1D, box).

In situ localization of rDNAs and telomeric sites. FISH mapping of 5S rDNA probe in chromosomes of A. aguaboensis showed three chromosomal sites: in pericentromeric regions of the short arms of chromosome pairs 2 and 25, and a subterminal site on the acrocentric 21 (Fig. 2A). In situ localization of 18S rDNA sites evidenced signals on the subterminal region of the short arms of chromosome pair 25, syntenic with 5S rDNA sites (Fig. 2A). FISH mapping of (TTAGGG)n sequence showed telomeres regions marked (Fig. 2B), without ITS vestiges.

FIGURE 2
| Karyotypes of Ancistrus aguaboensis (A-B) and Ancistrus cf. multispinis (C-D) submitted to FISH using 5S rDNA, 18S rDNA and (TTAGGG)n probes. In (A-C), 5S rDNA (in red) and 18S rDNA (in green) sites; in (B-D), terminal red markers evidenced (TTAGGG)n sites. Bar = 10 µm.

In situ localization of the 5S rDNA in A. cf. multispinis revealed sites on the subterminal regions of the short arms of acrocentric pairs 21 and 25, while 18S rDNA sites were located on the subterminal region of the short arms of acrocentric pair 24, which showed a variation in cistron size among the homologs (Fig. 2C). The FISH performed using telomeric sequence probes revealed only terminal chromosomal signals (Fig. 2D).

Analysis of 5S rDNA sequences. The 1193 bp-long 5S rDNA sequence obtained from A. aguaboensis (GenBank accession no. MT018470) presented 95% identity with 5S rDNA gene of Symphysodon sp. (GenBank accession no. KP715274.1). This sequence shows an 120 bp open reading frame (ORF), 1073 bp of the non-transcribed spacer (NTS), an internal promoter comprising box A (47 - 59 bp), the intermediate element (IE) and the box C (78 - 95 bp) and, a poli-T cluster (downstream from transcribed region), a TATA-like region (-36 to -33), a GC box (-17 to -15) and a Citosin -1. The analyses using the CENSOR software revealed a 30 bp DNA fragment (1048 to 1078 bp) with 90.62% identity with the transposable element (TE) Helitron from Oryza sativa (HELITRON3_OS).

The 1082 bp-long 5S rDNA sequence obtained from A. cf. multispinis (GenBank accession no. MT018471) showed 98% identity with 5S rDNA from Symphysodon sp. (GenBank accession no. KP715274.1). This sequence presents an 120 bp ORF and a 962 bp NTS. The internal promoter comprising box A (47 - 59 bp), IE and the box C (79 - 96 bp). The poli-T cluster (downstream from transcribed region), the TATA-like region (-33 to -26), GC box (-17 to -16) and a Citosin -1 were also detected. Analyses by CENSOR software revealed a 76 bp DNA fragment (736 to 812 bp) with 78.21% identity with the TE hAT from Salmo salar (hAT-35N1_SSa). According to Rfam, the obtained 5S rDNAs have identity to 5S rRNAs between the segments 1-117, E-value = 4.2-19 for A. aguaboensis and E-value = 1.3-23 for A. cf. multispinis.

DISCUSSION

Ancistrini and Hypostomini tribes show a wide range of 2n and karyotypes among their representatives (Bueno et al., 2012Bueno V, Zawadzki CH, Margarido VP. Trends in chromosome evolution in the genus Hypostomus Lacépède, 1803 (Osteichthyes, Loricariidae): a new perspective about the correlation between diploid number and chromosomes types. Rev Fish Biol Fish . 2012; 22:241-50. https://doi.org/10.1007/s11160-011-9215-9
https://doi.org/10.1007/s11160-011-9215-...
, 2018Bueno V, Konerat JT, Zawadzki CH, Venere PC, Blanco DR, Margarido VP. Divergent chromosome evolution in Hypostominae Tribes (Siluriformes: Loricariidae): correlation of chromosomal data with morphological and molecular phylogenies. Zebrafish. 2018; 15(5):492-503. https://doi.org/10.1089/zeb.2018.1612
https://doi.org/10.1089/zeb.2018.1612...
; Traldi et al., 2012Traldi JB, Vicari MR, Blanco DR, Martinez JF, Artoni RF, Moreira-Filho O. First karyotype description of Hypostomus iheringii (Regan, 1908): a case of heterochromatic polymorphism. Comp Cytogen. 2012; 6(2):115-25. https://doi.org/10.3897/CompCytogen.v6i2.2595
https://doi.org/10.3897/CompCytogen.v6i2...
; Lorscheider et al., 2018Lorscheider CA, Oliveira JIN, Dulz TA, Nogaroto V, Martins-Santos IC, Vicari MR. Comparative Cytogenetics Among Three Sympatric Hypostomus Species (Siluriformes: Loricariidae): An Evolutionary Analysis in a High Endemic Region. Braz Arch Biol Technol. 2018; 61:e18180417. https://doi.org/10.1590/1678-4324-2018180417
https://doi.org/10.1590/1678-4324-201818...
). Hypostomini presents high 2n values and diversified karyotypes, whilst in Ancistrini, numerous species of Ancistrus tend for the 2n reduction (Mariotto et al., 2011Mariotto S, Centofante L, Vicari MR, Artoni RF, Moreira-Filho O. Chromosomal diversification in ribosomal DNA sites in Ancistrus Kner, 1854 (Loricariidae, Ancistrini) from three hydrographic basins of Mato Grosso, Brazil. Comp Cytogenet. 2011; 5(4):289-300. https://doi.org/10.3897/CompCytogen.v5i4.1757
https://doi.org/10.3897/CompCytogen.v5i4...
; Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
; Bueno et al., 2018Bueno V, Konerat JT, Zawadzki CH, Venere PC, Blanco DR, Margarido VP. Divergent chromosome evolution in Hypostominae Tribes (Siluriformes: Loricariidae): correlation of chromosomal data with morphological and molecular phylogenies. Zebrafish. 2018; 15(5):492-503. https://doi.org/10.1089/zeb.2018.1612
https://doi.org/10.1089/zeb.2018.1612...
). Ancistrus cf. multispinis exhibits 2n = 52 chromosomes with half of the chromosomes carrying st/a morphology, while A. aguaboensis has 2n = 50 chromosomes and 48% of its are st/a chromosomes. Bueno et al. (2018Bueno V, Konerat JT, Zawadzki CH, Venere PC, Blanco DR, Margarido VP. Divergent chromosome evolution in Hypostominae Tribes (Siluriformes: Loricariidae): correlation of chromosomal data with morphological and molecular phylogenies. Zebrafish. 2018; 15(5):492-503. https://doi.org/10.1089/zeb.2018.1612
https://doi.org/10.1089/zeb.2018.1612...
) showed that species of Ancistrus with 2n close to 52 chromosomes have about 50% of st/a chromosomes in their karyotypes, while species with smaller 2n have considerably lower amounts of chromosomes with this morphology. Corroborating this proposal, the occurrence of fusion events of st/a chromosomes leads to the formation of m/sm chromosomes, and consequent reduction of 2n in some species of Ancistrus (Mariotto et al., 2011Mariotto S, Centofante L, Vicari MR, Artoni RF, Moreira-Filho O. Chromosomal diversification in ribosomal DNA sites in Ancistrus Kner, 1854 (Loricariidae, Ancistrini) from three hydrographic basins of Mato Grosso, Brazil. Comp Cytogenet. 2011; 5(4):289-300. https://doi.org/10.3897/CompCytogen.v5i4.1757
https://doi.org/10.3897/CompCytogen.v5i4...
; Favarato et al., 2016Favarato RM, Silva M, Oliveira RR, Artoni RF, Feldberg E, Matoso DA. Cytogenetic diversity and the evolutionary dynamics of rDNA genes and telomeric sequences in the Ancistrus genus (Loricariidae: Ancistrini). Zebrafish . 2016; 13(2):103-11. https://doi.org/10.1089/zeb.2015.1140
https://doi.org/10.1089/zeb.2015.1140...
; Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
).

Ancistrus cf. multispinis specimens (Ribeirão Grande, Paraíba do Sul basin) analyzed in this study share 2n = 52 chromosomes with A. multispinis of the Itapocu river from the coastal basin (Tab. 1, Alves et al., 2003Alves AL, Oliveira C, Foresti F. Karyotype variability in eight species of the subfamilies Loricariinae and Ancistrinae (Teleostei, Siluriformes, Loricariidae). Caryologia. 2003; 56(1):57-63. https://doi.org/10.1080/00087114.2003.10589308
https://doi.org/10.1080/00087114.2003.10...
). However, differences in karyotype formulas between the two populations indicate microstructural chromosomal changes in allopatric populations. The absence of ITS vestiges also corroborates the indication of a conserved karyotype for the species. Ancistrus aguaboensis has its first karyotype description in this study, and 2n = 50 chromosomes suggests a numerical reduction by centric fusion. Aiming the location of ITS vestiges in fused chromosomes, few species of Ancistrus had the detection of (TTAGGG)n sequence probes in their genome (Favarato et al., 2016Favarato RM, Silva M, Oliveira RR, Artoni RF, Feldberg E, Matoso DA. Cytogenetic diversity and the evolutionary dynamics of rDNA genes and telomeric sequences in the Ancistrus genus (Loricariidae: Ancistrini). Zebrafish . 2016; 13(2):103-11. https://doi.org/10.1089/zeb.2015.1140
https://doi.org/10.1089/zeb.2015.1140...
; Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
). In Ancistrus sp. (Barra Grande river, Paraná State, Ivaí basin), an ITS and 5S rDNA pseudogene were colocated on the metacentric pair 1 (Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
), as observed on the chromosome pair m2 of A. aguaboensis. In A. aguaboensis, no vestige of ITS was detected on the m/sm chromosomes, which may be a result of the loss of these ITS during the fusion event (Meyne et al., 1990Meyne J, Baker RJ, Hobart HH, Hsu TC, Ryder OA, Ward OG, Wiley JE, Wurster-Hill DH, Yates TL, Moyzis RK. Distribution of non-telomeric sites of the (TTAGGG)n telomeric sequence in vertebrate chromosomes. Chromosoma. 1990; 99(1):3-10. https://doi.org/10.1007/bf01737283
https://doi.org/10.1007/bf01737283...
). However, since EBRs can be reused in karyotype evolution (Pevzner, Tesler, 2003Pevzner PA, Tesler G. Human and mouse genomic sequences reveal extensive breakpoint reuse in mammalian evolution. Proc Natl Acad Sci USA. 2003; 100(13):7672-77. https://doi.org/10.1073/pnas.1330369100
https://doi.org/10.1073/pnas.1330369100...
), the presence of a 5S rDNA site in the proximal region of pair m2 indicate its origin from centric fusion with consequent loss of (TTAGGG)n sequences.

The distribution of heterochromatin in karyotypes is a feature widely evaluated in fishes (Kantek et al., 2009Kantek DLZ, Vicari MR, Peres WAM, Cestari MM, Artoni RF, Bertollo LAC, Moreira-Filho O. Chromosomal location and distribution of As51 satellite DNA in five species of the genus Astyanax (Teleostei, Characidae, Incertae sedis). J Fish Biol. 2009; 75(2):408-21. https://doi.org/10.1111/j.1095-8649.2009.02333.x
https://doi.org/10.1111/j.1095-8649.2009...
; Vicari et al., 2010Vicari MR, Nogaroto V, Noleto RB, Cestari, MM, Cioffi MB, Almeida MC, Moreira-Filho O, Bertollo LAC, Artoni RF. Satellite DNA and chromosomes in Neotropical fishes: Methods, applications and perspectives. J Fish Biol . 2010; 76(5):1094-116. https://doi.org/10.1111/j.1095-8649.2010.02564.x
https://doi.org/10.1111/j.1095-8649.2010...
). The location of chromosome-specific heterochromatic blocks can be useful and collaborate in the recognition of Rb fusion points (Rosa et al., 2012Rosa KO, Ziemniczak K, Barros AV, Nogaroto V, Almeida MC, Cestari MM, Artoni RF, Vicari MR. Numeric and structural chromosome polymorphism in Rineloricaria lima (Siluriformes: Loricariidae): fusion points carrying 5S rDNA or telomere sequence vestiges. Rev Fish Biol Fish . 2012; 22:739-49. https://doi.org/10.1007/s11160-011-9250-6
https://doi.org/10.1007/s11160-011-9250-...
; Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
; Glugoski et al., 2018Glugoski L, Giuliano-Caetano L, Moreira-Filho O, Vicari MR, Nogaroto V. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish. Gene. 2018; 650:49-54. https://doi.org/10.1016/j.gene.2018.01.099
https://doi.org/10.1016/j.gene.2018.01.0...
), or in the recognition of heteromorphic sex chromosomes (de Oliveira et al., 2007de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Karyotype characterization and ZZ/ZW sex chromosome heteromorphism in two species of the catfish genus Ancistrus Kner, 1854 (Siluriformes: Loricariidae) from the Amazon basin. Neotrop Ichthyol . 2007; 5(3):301-06. https://doi.org/10.1590/S1679-62252007000300010
https://doi.org/10.1590/S1679-6225200700...
, 2008de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Occurrence of multiple sexual chromosomes (XX/XY1Y2 and Z1Z1Z2Z2/Z1Z2W1W2) in catfishes of the genus Ancistrus (Siluriformes: Loricariidae) from the Amazon basin. Genetica . 2008; 134(2):243-49. https://doi.org/10.1007/s10709-007-9231-9
https://doi.org/10.1007/s10709-007-9231-...
, 2009de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Mechanisms of chromosomal evolution and its possible relation to natural history characteristics in Ancistrus catfishes (Siluriformes: Loricariidae). J Fish Biol . 2009; 75(9):2209-25. https://doi.org/10.1111/j.1095-8649.2009.02450.x
https://doi.org/10.1111/j.1095-8649.2009...
; Mariotto et al., 2011Mariotto S, Centofante L, Vicari MR, Artoni RF, Moreira-Filho O. Chromosomal diversification in ribosomal DNA sites in Ancistrus Kner, 1854 (Loricariidae, Ancistrini) from three hydrographic basins of Mato Grosso, Brazil. Comp Cytogenet. 2011; 5(4):289-300. https://doi.org/10.3897/CompCytogen.v5i4.1757
https://doi.org/10.3897/CompCytogen.v5i4...
; Konerat et al., 2015Konerat JT, Bueno V, Margarido VP, Portela-Castro, ALB, Martins-Santos IC. Diversity of Sex Chromosome Systems in Ancistrini (Loricariidae, Hypostominae): ZZ/ZW in Ancistrus taunayi Miranda Ribeiro, 1918. Cytogenet Genome Res. 2015; 146(4):306-10. https://doi.org/10.1159/000441431
https://doi.org/10.1159/000441431...
; Favarato et al., 2016Favarato RM, Silva M, Oliveira RR, Artoni RF, Feldberg E, Matoso DA. Cytogenetic diversity and the evolutionary dynamics of rDNA genes and telomeric sequences in the Ancistrus genus (Loricariidae: Ancistrini). Zebrafish . 2016; 13(2):103-11. https://doi.org/10.1089/zeb.2015.1140
https://doi.org/10.1089/zeb.2015.1140...
; Schemberger et al., 2019Schemberger MO, Nascimento VD, Coan R, Ramos E, Nogaroto V, Ziemniczak K, Valente GT, Moreira-Filho O, Martins C, Vicari MR. DNA transposon invasion and microsatellite accumulation guide W chromosome differentiation in a Neotropical fish genome. Chromosoma . 2019; 128(4):547-60. https://doi.org/10.1007/s00412-019-00721-9
https://doi.org/10.1007/s00412-019-00721...
). Ancistrus cf. multispinis and A. aguaboensis presented large heterochromatic blocks in some chromosomal pairs, however, with no indication of sex chromosome heteromorphisms. The presence of large heterochromatic blocks is a feature widely shared in Ancistrus (Mariotto et al., 2011Mariotto S, Centofante L, Vicari MR, Artoni RF, Moreira-Filho O. Chromosomal diversification in ribosomal DNA sites in Ancistrus Kner, 1854 (Loricariidae, Ancistrini) from three hydrographic basins of Mato Grosso, Brazil. Comp Cytogenet. 2011; 5(4):289-300. https://doi.org/10.3897/CompCytogen.v5i4.1757
https://doi.org/10.3897/CompCytogen.v5i4...
; Konerat et al., 2015Konerat JT, Bueno V, Margarido VP, Portela-Castro, ALB, Martins-Santos IC. Diversity of Sex Chromosome Systems in Ancistrini (Loricariidae, Hypostominae): ZZ/ZW in Ancistrus taunayi Miranda Ribeiro, 1918. Cytogenet Genome Res. 2015; 146(4):306-10. https://doi.org/10.1159/000441431
https://doi.org/10.1159/000441431...
; Favarato et al., 2016Favarato RM, Silva M, Oliveira RR, Artoni RF, Feldberg E, Matoso DA. Cytogenetic diversity and the evolutionary dynamics of rDNA genes and telomeric sequences in the Ancistrus genus (Loricariidae: Ancistrini). Zebrafish . 2016; 13(2):103-11. https://doi.org/10.1089/zeb.2015.1140
https://doi.org/10.1089/zeb.2015.1140...
), whereas the absence of large heterochromatin blocks has been described to be a plesiomorphic characteristic in Loricariidae (Ziemniczak et al., 2012Ziemniczak K, Barros AV, Rosa KO, Nogaroto V, Almeida MC, Cestari MM, Moreira-Filho O, Artoni RF, Vicari MR. Comparative cytogenetics of Loricariidae (Actinopterygii: Siluriformes): emphasis in Neoplecostominae and Hypoptopomatinae. Ital J Zool. 2012; 79(4):492-501. https://doi.org/10.1080/11250003.2012.676677
https://doi.org/10.1080/11250003.2012.67...
).

A single chromosome pair carrying 45S rDNA (NOR) is a characteristic shared in all analyzed Ancistrus species (Bueno et al., 2018Bueno V, Konerat JT, Zawadzki CH, Venere PC, Blanco DR, Margarido VP. Divergent chromosome evolution in Hypostominae Tribes (Siluriformes: Loricariidae): correlation of chromosomal data with morphological and molecular phylogenies. Zebrafish. 2018; 15(5):492-503. https://doi.org/10.1089/zeb.2018.1612
https://doi.org/10.1089/zeb.2018.1612...
). Ancistrus cf. multispinis and A. aguaboensis also had only a single pair carrying the 45S rDNA, but on different chromosomes. While A. cf. multispinis did not present co-located 45S/5S rDNAs, in A. aguaboensis these clusters were located in synteny in an acrocentric pair. In other Ancistrus species, the location of the 45S rDNA has also been shown to be widely varied (see Tab. 1). The 45S rDNAs sites in different chromosomal locations, in chromosomes pairs showing different sizes and morphologies and, in condition of synteny to the 5S rDNA, indicate several transpositions and/or other structural events involving the 45S rDNA in Ancistrus. Hence, the 45S rDNA site was considered an important cytotaxonomic marker in the group due to its wide chromosomal location variation, being in innumerous cases, species-specific (Mariotto et al., 2011Mariotto S, Centofante L, Vicari MR, Artoni RF, Moreira-Filho O. Chromosomal diversification in ribosomal DNA sites in Ancistrus Kner, 1854 (Loricariidae, Ancistrini) from three hydrographic basins of Mato Grosso, Brazil. Comp Cytogenet. 2011; 5(4):289-300. https://doi.org/10.3897/CompCytogen.v5i4.1757
https://doi.org/10.3897/CompCytogen.v5i4...
).

While the 45S rDNA is located in a single chromosome pair in Ancistrus, the 5S rDNA can be present in a large number of chromosomal sites (ranging from 1 to 13 chromosome pairs) in the different species analyzed (see Tab. 1). Barros et al. (2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
) proposed the dispersion of 5S rDNAs, and their pseudogenes, in subterminal regions of st/a chromosomes. EBRs located close to 5S rDNA pseudogenes could promote DSB and Rb fusion events (Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
). In fact, A. cf. multispinis and A. aguaboensis presented 5S rDNA sites in the subterminal regions of acrocentric pairs. In addition, A. aguaboensis presented 5S rDNA sequences at proximal region in the pair m2. Variations in the 5S rDNA location occurs in Ancistrus species, but the proximal 5S rDNA location in heterochromatic regions, with or without ITS vestiges, may explain a part of the Rb fusions present in the genus.

Previous cytogenetic studies in Trichomycteridae, Neoplecostominae and Hypoptopomatinae species proposed that the 45S/5S rDNA syntenic condition was present in the karyotypes of sister group for Loricariidae (Ziemniczak et al., 2012Ziemniczak K, Barros AV, Rosa KO, Nogaroto V, Almeida MC, Cestari MM, Moreira-Filho O, Artoni RF, Vicari MR. Comparative cytogenetics of Loricariidae (Actinopterygii: Siluriformes): emphasis in Neoplecostominae and Hypoptopomatinae. Ital J Zool. 2012; 79(4):492-501. https://doi.org/10.1080/11250003.2012.676677
https://doi.org/10.1080/11250003.2012.67...
). Syntenic condition of rDNAs is widely visualized in karyotypes of Loricariidae representatives (Kavalco et al., 2004Kavalco KF, Pazza R, Bertollo LAC, Moreira-Filho O. Heterochromatin characterization of four fish species of the family Loricariidae (Siluriformes). Hereditas . 2004; 141(3):237-42. https://doi.org/10.1111/j.1601-5223.2004.01850.x
https://doi.org/10.1111/j.1601-5223.2004...
; Mariotto et al., 2011Mariotto S, Centofante L, Vicari MR, Artoni RF, Moreira-Filho O. Chromosomal diversification in ribosomal DNA sites in Ancistrus Kner, 1854 (Loricariidae, Ancistrini) from three hydrographic basins of Mato Grosso, Brazil. Comp Cytogenet. 2011; 5(4):289-300. https://doi.org/10.3897/CompCytogen.v5i4.1757
https://doi.org/10.3897/CompCytogen.v5i4...
; Ziemniczak et al., 2012Ziemniczak K, Barros AV, Rosa KO, Nogaroto V, Almeida MC, Cestari MM, Moreira-Filho O, Artoni RF, Vicari MR. Comparative cytogenetics of Loricariidae (Actinopterygii: Siluriformes): emphasis in Neoplecostominae and Hypoptopomatinae. Ital J Zool. 2012; 79(4):492-501. https://doi.org/10.1080/11250003.2012.676677
https://doi.org/10.1080/11250003.2012.67...
; Traldi et al., 2013Traldi JB, Blanco DR, Vicari MR, Martinez JF, Lui RL, Barros AV, Artoni RF, Moreira-Filho O. Chromosomal diversity in Hypostomus (Siluriformes, Loricariidae) with emphasis on physical mapping of 18S and 5S rDNA sites. Genet Mol Res . 2013; 12(1):463-71. https://doi.org/10.4238/2013.February.8.11
https://doi.org/10.4238/2013.February.8....
; Bueno et al., 2014Bueno V, Venere PC, Konerat JT, Zawadzki CH, Vicari MR, Margarido VP. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): Evolutionary tendencies in the genus. Sci World J. 2014; 2014(3):1-8. https://doi.org/10.1155/2014/943825
https://doi.org/10.1155/2014/943825...
; Favarato et al., 2016Favarato RM, Silva M, Oliveira RR, Artoni RF, Feldberg E, Matoso DA. Cytogenetic diversity and the evolutionary dynamics of rDNA genes and telomeric sequences in the Ancistrus genus (Loricariidae: Ancistrini). Zebrafish . 2016; 13(2):103-11. https://doi.org/10.1089/zeb.2015.1140
https://doi.org/10.1089/zeb.2015.1140...
; Barros et al., 2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
). Analyzing the location of chromosome types and the position of rDNAs synteny sites in Ancistrini, it is more parsimonious to infer evolutionary recurrence indexes for this chromosome condition in this tribe. In fact, when evaluating the pattern of the karyotype distribution of rDNAs in Ancistrus, although it may be an allusive proposal, it is possible to corroborate the proposal of Barros et al. (2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
), which rDNAs pseudogenes can organize EBRs and, these EBRs, have an evolutionary re-use to generate chromosome diversification in the group.

The analysis of the 5S rDNAs sequences of A. cf. multispinis and A. aguaboensis demonstrated that they have all the structures necessary for their function, although this analysis can be only predictive. Unlike the studies proposed by Barros et al. (2017Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
https://doi.org/10.1016/j.gene.2017.01.0...
) and Glugoski et al. (2018Glugoski L, Giuliano-Caetano L, Moreira-Filho O, Vicari MR, Nogaroto V. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish. Gene. 2018; 650:49-54. https://doi.org/10.1016/j.gene.2018.01.099
https://doi.org/10.1016/j.gene.2018.01.0...
), 5S rDNA pseudogenes were not recovered in our analyzes. Pseudogenes are common in multigene families (Rebordinos et al., 2013Rebordinos L, Cross I, Merlo A. High evolutionary dynamism in 5S rDNA of fish: state of the art. Cytogenet Genome Res . 2013; 141(2-3):103-13. https://doi.org/10.1159/000354871
https://doi.org/10.1159/000354871...
). It is difficult to detect EBRs in multigene families, which depends of a large number of sequence analysis or the use of comparative genomics. Thus, the detailed assessment of the presence of EBRs in 5S rDNA pseudogenes/degenerated sequences still remains predictive. However, in Ancistrus species with 2n ≤ 50 chromosomes, the presence of 5S rDNA sites on m/sm chromosomes, originated from Rb fusion, could explain part of the chromosome diversification in the genus.

Ancistrus aguaboensis and A. cf. multispinis are found in sympatry and syntopy with species of Harttia punctata and Harttia carvalhoi, respectively. These species show karyotype diversity, with the absence of sex chromosomes in A. aguaboensis and A. cf. multispinis, however with the presence of multiple sex chromosomes systems in Harttia punctata (X1X1X2X2/X1X2Y) and in Harttia carvalhoi (XX/XY1Y2) (Blanco et al., 2013Blanco DR, Vicari MR, Lui RL, Bertollo LA, Traldi JB, Moreira-Filho O. The role of the Robertsonian rearrangements in the origin of the XX/XY1Y2 sex chromosome system and in the chromosomal differentiation in Harttia species (Siluriformes, Loricariidae). Rev Fish Biol Fish. 2013; 23:127-34. https://doi.org/10.1007/s11160-012-9283-5
https://doi.org/10.1007/s11160-012-9283-...
, 2014Blanco DR, Vicari MR, Lui RL, Artoni RF, Almeida MC, Traldi JB, Margarido VP, Moreira- Filho O. Origin of the X1X1X2X2/X1X2Y sex chromosome system of Harttia punctata (Siluriformes, Loricariidae) inferred from chromosome painting and FISH with ribosomal DNA markers. Genetica ; 2014; 142(2):119-26. https://doi.org/10.1007/s10709-014-9759-4
https://doi.org/10.1007/s10709-014-9759-...
). These armored catfishes inhabit small tributaries, which favors the isolation of populations, providing events of chromosome rearrangements that could be more easily fixed. This cytogenetic differentiation may be functioning as a reproductive barrier between species, a fact confirmed by the absence of hybrid species.

The wide karyotype diversification present in Ancistrus (Bueno et al., 2018Bueno V, Konerat JT, Zawadzki CH, Venere PC, Blanco DR, Margarido VP. Divergent chromosome evolution in Hypostominae Tribes (Siluriformes: Loricariidae): correlation of chromosomal data with morphological and molecular phylogenies. Zebrafish. 2018; 15(5):492-503. https://doi.org/10.1089/zeb.2018.1612
https://doi.org/10.1089/zeb.2018.1612...
) is compatible with the fact that the group is diverse and specious (Lujan et al., 2015Lujan NK, Armbruster JW, Lovejoy NR, López-Fernández H. Multilocus molecular phylogeny of the suckermouth armored catfishes (Siluriformes: Loricariidae) with a focus on subfamily Hypostominae. Mol Phylogenetics Evol. 2015; 82PtA:269-88. https://doi.org/10.1016/j.ympev.2014.08.020
https://doi.org/10.1016/j.ympev.2014.08....
). Chromosome rearrangements promote important differences in the genomic sets of species, which could lead to meiotic incompatibilities (Navarro, Barton, 2003Navarro A, Barton NH. Accumulating postzygotic isolation genes in parapatry: a new twist on chromosomal speciation. Evolution. 2003; 57(3):447-59. https://doi.org/10.1111/j.0014-3820.2003.tb01537.x
https://doi.org/10.1111/j.0014-3820.2003...
). Chromosome segregation failure and the ensuing production of unviable gametes due to the accumulation of chromosomal rearrangements might play an important role in speciation (Navarro, Barton, 2003Navarro A, Barton NH. Accumulating postzygotic isolation genes in parapatry: a new twist on chromosomal speciation. Evolution. 2003; 57(3):447-59. https://doi.org/10.1111/j.0014-3820.2003.tb01537.x
https://doi.org/10.1111/j.0014-3820.2003...
; Faria, Navarro, 2010Faria R, Navarro A. Chromosomal speciation revisited: Rearranging theory with pieces of evidence. Trends Ecol Evol. 2010; 25(11):660-69. https://doi.org/10.1016/j.tree.2010.07.008
https://doi.org/10.1016/j.tree.2010.07.0...
). In the same way, the genetic differences accumulated in divergent Ancistrus species may have helped in the diversification of this evolutionary lineage.

ACKNOWLEDGMENTS

This study was financed by FAPESP (Fundacão de Amparo à Pesquisa do Estado de São Paulo), CAPES (Coordenacão de Aperfeiçoamento de Pessoal de Nível Superior - Financial Code 001) and CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico). The authors are grateful to ICMBio (Instituto Chico Mendes de Conservação da Biodiversidade - protocol number SISBIO 10538-1) for authorizing the capture of specimens.

REFERENCES

  • Alves AL, Oliveira C, Foresti F. Karyotype variability in eight species of the subfamilies Loricariinae and Ancistrinae (Teleostei, Siluriformes, Loricariidae). Caryologia. 2003; 56(1):57-63. https://doi.org/10.1080/00087114.2003.10589308
    » https://doi.org/10.1080/00087114.2003.10589308
  • Alves AL, Oliveira C, Nirchio M, Granado A, Foresti F. Karyotypic relationship among the tribes of Hypostominae (Siluriformes: Loricariidae) with description of X0 sex chromosome system in a Neotropical fish species. Genetica. 2006; 128(1-3):1-9. https://doi.org/10.1007/s10709-005-0715-1
    » https://doi.org/10.1007/s10709-005-0715-1
  • Armbruster JW. Phylogenetic relationships of the suckermouth armoured catfishes (Loricariidae) with emphasis on the Hypostominae and the Ancistrinae. Zool J Linn Soc. 2004; 141(1):1-80. https://doi.org/10.1111/j.1096-3642.2004.00109.x
    » https://doi.org/10.1111/j.1096-3642.2004.00109.x
  • Armbruster JW. The genus Peckoltia with the description of two new species and a reanalysis of the phylogeny of the genera of the Hypostominae (Siluriformes: Loricariidae). Zootaxa. 2008; 1822:1-76. https://doi.org/10.11646/zootaxa.1822.1.1
    » https://doi.org/10.11646/zootaxa.1822.1.1
  • Artoni RF, Bertollo LAC. Trends in the Karyotype Evolution of Loricariidae Fish (Siluriformes). Hereditas. 2001; 134(3):201-10. https://doi.org/10.1111/j.1601-5223.2001.00201.x
    » https://doi.org/10.1111/j.1601-5223.2001.00201.x
  • Barbosa P, Pucci MB, Nogaroto V, Almeida MC, Artoni RF, Vicari MR. Karyotype analysis of three species of Corydoras (Siluriformes: Callichthyidae) from southern Brazil: rearranged karyotypes and cytotaxonomy. Neotrop Ichthyol. 2017; 15(1):e160056. https://doi.org/10.1590/1982-0224-20160056
    » https://doi.org/10.1590/1982-0224-20160056
  • Barros AV, Wolski MAV, Nogaroto V, Almeida MC, Moreira-Filho O, Vicari MR. Fragile sites, dysfunctional telomere and chromosome fusions: what is 5S rDNA role? Gene. 2017; 608:20-27. https://doi.org/10.1016/j.gene.2017.01.013
    » https://doi.org/10.1016/j.gene.2017.01.013
  • Bellafronte E, Margarido VP, Moreira-Filho O. Cytotaxonomy of Parodon nasus and Parodon tortuosus (Pisces, Characiformes). A case of synonymy confirmed by cytogenetic analyses. Genet Mol Biol. 2005; 28(4):710-16. https://doi.org/10.1590/S1415-47572005000500010
    » https://doi.org/10.1590/S1415-47572005000500010
  • Bertollo LAC, Cioffi MB, Moreira-Filho O. Direct chromosome preparation from freshwater teleost fishes. In: Ozouf-Costaz C, Pisano E, Foresti F, Almeida Toledo LF, editors. Fish cytogenetic techniques (Ray-Fin Fishes and Chondrichthyans). Enfield USA: CRC Press; 2015. p.21-26. https://doi.org/10.1201/b18534-4
    » https://doi.org/10.1201/b18534-4
  • Blanco DR, Vicari MR, Lui RL, Bertollo LA, Traldi JB, Moreira-Filho O. The role of the Robertsonian rearrangements in the origin of the XX/XY1Y2 sex chromosome system and in the chromosomal differentiation in Harttia species (Siluriformes, Loricariidae). Rev Fish Biol Fish. 2013; 23:127-34. https://doi.org/10.1007/s11160-012-9283-5
    » https://doi.org/10.1007/s11160-012-9283-5
  • Blanco DR, Vicari MR, Lui RL, Artoni RF, Almeida MC, Traldi JB, Margarido VP, Moreira- Filho O. Origin of the X1X1X2X2/X1X2Y sex chromosome system of Harttia punctata (Siluriformes, Loricariidae) inferred from chromosome painting and FISH with ribosomal DNA markers. Genetica ; 2014; 142(2):119-26. https://doi.org/10.1007/s10709-014-9759-4
    » https://doi.org/10.1007/s10709-014-9759-4
  • Bueno V, Zawadzki CH, Margarido VP. Trends in chromosome evolution in the genus Hypostomus Lacépède, 1803 (Osteichthyes, Loricariidae): a new perspective about the correlation between diploid number and chromosomes types. Rev Fish Biol Fish . 2012; 22:241-50. https://doi.org/10.1007/s11160-011-9215-9
    » https://doi.org/10.1007/s11160-011-9215-9
  • Bueno V, Venere PC, Konerat JT, Zawadzki CH, Vicari MR, Margarido VP. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): Evolutionary tendencies in the genus. Sci World J. 2014; 2014(3):1-8. https://doi.org/10.1155/2014/943825
    » https://doi.org/10.1155/2014/943825
  • Bueno V, Konerat JT, Zawadzki CH, Venere PC, Blanco DR, Margarido VP. Divergent chromosome evolution in Hypostominae Tribes (Siluriformes: Loricariidae): correlation of chromosomal data with morphological and molecular phylogenies. Zebrafish. 2018; 15(5):492-503. https://doi.org/10.1089/zeb.2018.1612
    » https://doi.org/10.1089/zeb.2018.1612
  • Charlesworth B, Snegowski P, Stephan W. The evolutionary dynamics of repetitive DNA in eukaryotes. Nature. 1994; 371(6494):215-20. https://doi.org/10.1038/371215a0
    » https://doi.org/10.1038/371215a0
  • Errero-Porto F, Vieira MMR, Barbosa LM, Borin-Carvalho LA, Vicari MR, Portela-Castro ALB, Martins-Santos IC. Chromosomal Polymorphism in Rineloricaria Lanceolata Günther, 1868 (Loricariidae: Loricariinae) of the Paraguay Basin (Mato Grosso do Sul, Brazil): Evidence of Fusions and Their Consequences in the Population. Zebrafish . 2014; 11(4):318-24. https://doi.org/10.1089/zeb.2014.0996
    » https://doi.org/10.1089/zeb.2014.0996
  • Faria R, Navarro A. Chromosomal speciation revisited: Rearranging theory with pieces of evidence. Trends Ecol Evol. 2010; 25(11):660-69. https://doi.org/10.1016/j.tree.2010.07.008
    » https://doi.org/10.1016/j.tree.2010.07.008
  • Favarato RM, Silva M, Oliveira RR, Artoni RF, Feldberg E, Matoso DA. Cytogenetic diversity and the evolutionary dynamics of rDNA genes and telomeric sequences in the Ancistrus genus (Loricariidae: Ancistrini). Zebrafish . 2016; 13(2):103-11. https://doi.org/10.1089/zeb.2015.1140
    » https://doi.org/10.1089/zeb.2015.1140
  • Ferraris CJ Jr. Checklist of catfishes, recent and fossil (Osteichthyes: Siluriformes), and catalogue of Siluriform primary types. Zootaxa. 2007; 1418:1-628. http://dx.doi.org/10.11646/zootaxa.1418.1.1
    » http://dx.doi.org/10.11646/zootaxa.1418.1.1
  • Fricke R, Eschmeyer WN, Fong JD. Species by subfamily/ subfamily [Internet]. San Francisco: California Academy of Science; 2020. Available from: http://researcharchive.calacademy.org/research/ichthyology/catalog/SpeciesByFamily.asp
    » http://researcharchive.calacademy.org/research/ichthyology/catalog/SpeciesByFamily.asp
  • Glugoski L, Giuliano-Caetano L, Moreira-Filho O, Vicari MR, Nogaroto V. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish. Gene. 2018; 650:49-54. https://doi.org/10.1016/j.gene.2018.01.099
    » https://doi.org/10.1016/j.gene.2018.01.099
  • Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. 1999; 41:95-98. https://doi.org/10.14601/Phytopathol_Mediterr-14998u1.29
    » https://doi.org/10.14601/Phytopathol_Mediterr-14998u1.29
  • Hatanaka T, Galetti PM Jr. Mapping of the 18S and 5S ribosomal RNA genes in the fish Prochilodus argenteus Agassiz, 1829 (Characiformes, Prochilodontidae). Genetica . 2004; 122(3): 239-44. https://doi.org/10.1007/s10709-004-2039-y
    » https://doi.org/10.1007/s10709-004-2039-y
  • Howell WM, Black DA. Controlled silver-staining of nucleolus organizer regions with a protective colloidal developer: a 1-step method. Experientia. 1980; 36(8):1014-15. https://doi.org/10.1007/bf01953855
    » https://doi.org/10.1007/bf01953855
  • Ijdo JW, Wells RA, Baldini A, Reeders ST. Improved telomere detection using a telomere repeat probe (TTAGGG)n generated by PCR. Nucleic Acids Res. 1991; 19(17):4780. https://doi.org/10.1093/nar/19.17.4780
    » https://doi.org/10.1093/nar/19.17.4780
  • Kantek DLZ, Vicari MR, Peres WAM, Cestari MM, Artoni RF, Bertollo LAC, Moreira-Filho O. Chromosomal location and distribution of As51 satellite DNA in five species of the genus Astyanax (Teleostei, Characidae, Incertae sedis). J Fish Biol. 2009; 75(2):408-21. https://doi.org/10.1111/j.1095-8649.2009.02333.x
    » https://doi.org/10.1111/j.1095-8649.2009.02333.x
  • Kavalco KF, Pazza R, Bertollo LAC, Moreira-Filho O. Heterochromatin characterization of four fish species of the family Loricariidae (Siluriformes). Hereditas . 2004; 141(3):237-42. https://doi.org/10.1111/j.1601-5223.2004.01850.x
    » https://doi.org/10.1111/j.1601-5223.2004.01850.x
  • Konerat JT, Bueno V, Margarido VP, Portela-Castro, ALB, Martins-Santos IC. Diversity of Sex Chromosome Systems in Ancistrini (Loricariidae, Hypostominae): ZZ/ZW in Ancistrus taunayi Miranda Ribeiro, 1918. Cytogenet Genome Res. 2015; 146(4):306-10. https://doi.org/10.1159/000441431
    » https://doi.org/10.1159/000441431
  • Levan A, Fredga K, Sandberg AA. Nomenclature for centromeric position on chromosomes. Hereditas . 1964; 52(2):201-20. https://doi.org/10.1111/j.1601-5223.1964.tb01953.x
    » https://doi.org/10.1111/j.1601-5223.1964.tb01953.x
  • Long EO, Dawid IB. Repeated genes in eukaryotes. Annu Rev Biochem. 1980; 49:727-64. https://doi.org/10.1146/annurev.bi.49.070180.003455
    » https://doi.org/10.1146/annurev.bi.49.070180.003455
  • Lorscheider CA, Oliveira JIN, Dulz TA, Nogaroto V, Martins-Santos IC, Vicari MR. Comparative Cytogenetics Among Three Sympatric Hypostomus Species (Siluriformes: Loricariidae): An Evolutionary Analysis in a High Endemic Region. Braz Arch Biol Technol. 2018; 61:e18180417. https://doi.org/10.1590/1678-4324-2018180417
    » https://doi.org/10.1590/1678-4324-2018180417
  • Lujan NK, Roach KA, Jacobsen D, Winemiller KO, Vargas VM, Ching VR, Maestre JA. Aquatic community structure across an Andes-to-Amazon fluvial gradient. J Biogeogr. 2013; 40(9):1715-28. https://doi.org/10.1111/jbi.12131
    » https://doi.org/10.1111/jbi.12131
  • Lujan NK, Armbruster JW, Lovejoy NR, López-Fernández H. Multilocus molecular phylogeny of the suckermouth armored catfishes (Siluriformes: Loricariidae) with a focus on subfamily Hypostominae. Mol Phylogenetics Evol. 2015; 82PtA:269-88. https://doi.org/10.1016/j.ympev.2014.08.020
    » https://doi.org/10.1016/j.ympev.2014.08.020
  • Mariotto S, Artoni RF, Miyazawa CS. Occurence of sexual chromosome, of the type ZZ/ZW, in Ancistrus cf. dubius (Loricariidae: Ancistrinae) of the Paraguay River Basin, Mato Grosso, Brazil. Caryologia . 2004; 57(4):327-31. https://doi.org/10.1080/00087114.2004.10589413
    » https://doi.org/10.1080/00087114.2004.10589413
  • Mariotto S, Miyazawa CS. Ancistrus cf. dubius (Siluriformes: Ancistrinae), a complex of species. 1. Chromosomal characterization of four populations and occurrence of sex chromosomes of the type XX/XY, in the Pantanal Basin of Mato Grosso, Brazil. Caryologia . 2006; 59(4):299-304. https://doi.org/10.1080/00087114.2006.10797929
    » https://doi.org/10.1080/00087114.2006.10797929
  • Mariotto S, Centofante L, Miyazawa CS, Bertollo LAC, Moreira-Filho O. Chromosome polymorphism in Ancistrus cuiabae Knaack, 1999 (Siluriformes: Loricariidae: Ancistrini). Neotrop Ichthyol . 2009; 7(4):595-600. https://doi.org/10.1590/S1679-62252009000400006
    » https://doi.org/10.1590/S1679-62252009000400006
  • Mariotto S, Centofante L, Vicari MR, Artoni RF, Moreira-Filho O. Chromosomal diversification in ribosomal DNA sites in Ancistrus Kner, 1854 (Loricariidae, Ancistrini) from three hydrographic basins of Mato Grosso, Brazil. Comp Cytogenet. 2011; 5(4):289-300. https://doi.org/10.3897/CompCytogen.v5i4.1757
    » https://doi.org/10.3897/CompCytogen.v5i4.1757
  • Mariotto S, Centofante L, Moreira-Filho O. Diversity and chromosomal evolution in the genus Ancistrus Kner, 1854 (Loricariidae: Ancistrini) from three hydrographic basins of Mato Grosso State, Brazil. Neotrop Ichthyol . 2013; 11(1):125 - 31. https://doi.org/10.1590/S1679-62252013000100015
    » https://doi.org/10.1590/S1679-62252013000100015
  • Martins C, Galetti PM Jr. Chromosomal localization of 5S rDNA genes in Leporinus Fish (Anostomidae, Characiformes). Chromosome Res. 1999; 7(5):363-67. https://doi.org/10.1023/a:1009216030316
    » https://doi.org/10.1023/a:1009216030316
  • Maxon R, Cohn R, Kedes L, Mohun T. Expression and organization of histone genes. Annu Rev Genet. 1983; 17:239-77. https://doi.org/10.1146/annurev.ge.17.120183.001323
    » https://doi.org/10.1146/annurev.ge.17.120183.001323
  • Meyne J, Baker RJ, Hobart HH, Hsu TC, Ryder OA, Ward OG, Wiley JE, Wurster-Hill DH, Yates TL, Moyzis RK. Distribution of non-telomeric sites of the (TTAGGG)n telomeric sequence in vertebrate chromosomes. Chromosoma. 1990; 99(1):3-10. https://doi.org/10.1007/bf01737283
    » https://doi.org/10.1007/bf01737283
  • Nascimento VD, Coelho KA, Nogaroto V, Almeida RB, Ziemniczak K, Centofante L, Pavanelli CS, Torres RA, Moreira-Filho O, Vicari MR. Do multiple karyomorphs and population genetics of freshwater darter characines (Apareiodon affinis) indicate chromosomal speciation? Zool Anz. 2018; 272:93-103. https://doi.org/10.1016/j.jcz.2017.12.006
    » https://doi.org/10.1016/j.jcz.2017.12.006
  • Navarro A, Barton NH. Accumulating postzygotic isolation genes in parapatry: a new twist on chromosomal speciation. Evolution. 2003; 57(3):447-59. https://doi.org/10.1111/j.0014-3820.2003.tb01537.x
    » https://doi.org/10.1111/j.0014-3820.2003.tb01537.x
  • de Oliveira RR, Souza IL, Venere PC. Karyotype description of three species of Loricariidae (Siluriformes) and occurrence of the ZZ/ZW sexual system in Hemiancistrus spilomma Cardoso & Lucinda, 2003. Neotrop Ichthyol . 2006; 4(1):93- 97. https://doi.org/10.1590/S1679-62252006000100010
    » https://doi.org/10.1590/S1679-62252006000100010
  • de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Karyotype characterization and ZZ/ZW sex chromosome heteromorphism in two species of the catfish genus Ancistrus Kner, 1854 (Siluriformes: Loricariidae) from the Amazon basin. Neotrop Ichthyol . 2007; 5(3):301-06. https://doi.org/10.1590/S1679-62252007000300010
    » https://doi.org/10.1590/S1679-62252007000300010
  • de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Occurrence of multiple sexual chromosomes (XX/XY1Y2 and Z1Z1Z2Z2/Z1Z2W1W2) in catfishes of the genus Ancistrus (Siluriformes: Loricariidae) from the Amazon basin. Genetica . 2008; 134(2):243-49. https://doi.org/10.1007/s10709-007-9231-9
    » https://doi.org/10.1007/s10709-007-9231-9
  • de Oliveira RR, Feldberg E, Anjos MB, Zuanon J. Mechanisms of chromosomal evolution and its possible relation to natural history characteristics in Ancistrus catfishes (Siluriformes: Loricariidae). J Fish Biol . 2009; 75(9):2209-25. https://doi.org/10.1111/j.1095-8649.2009.02450.x
    » https://doi.org/10.1111/j.1095-8649.2009.02450.x
  • Oliveira MLM, Utsunomia R, Pansonato-Alves JC, Scacchetti PC, Primo CC, Vicari MR, Artoni RF, Centofante L, Moreira-Filho O, Oliveira C, Foresti F. Microstructural chromosome reorganization in the genus Trichomycterus (Siluriformes: Trichomycteridae). Neotrop Ichthyol . 2016; 14(2):e150084. https://doi.org/10.1590/1982-0224-20150084
    » https://doi.org/10.1590/1982-0224-20150084
  • Pevzner PA, Tesler G. Human and mouse genomic sequences reveal extensive breakpoint reuse in mammalian evolution. Proc Natl Acad Sci USA. 2003; 100(13):7672-77. https://doi.org/10.1073/pnas.1330369100
    » https://doi.org/10.1073/pnas.1330369100
  • Pinkel D, Straume T, Gray JW. Cytogenetic analysis using quantitative, high-sensitivity, fluorescence hybridization. Proc Natl Acad Sci USA . 1986; 83(9):2934-38. https://doi.org/10.1073/pnas.83.9.2934
    » https://doi.org/10.1073/pnas.83.9.2934
  • Primo CC, Glugoski L, Almeida MC, Zawadzki HC, Moreira-Filho O, Vicari MR, Nogaroto V. Mechanisms of chromosomal diversification in species of Rineloricaria (Actinopterygii: Siluriformes: Loricariidae). Zebrafish . 2017; 14(2):161-68. https://doi.org/10.1089/zeb.2016.1386
    » https://doi.org/10.1089/zeb.2016.1386
  • Primo CC, Glugoski L, Vicari MR, Nogaroto V. Chromosome Mapping and Molecular Characterization of the Tc1/Mariner Element in Rineloricaria (Siluriformes: Loricariidae). Braz Arch Biol Technol . 2018; 61:e18170623. https://doi.org/10.1590/1678-4324-2018170623
    » https://doi.org/10.1590/1678-4324-2018170623
  • Prizon AC, Borin-Carvalho LA, Bruschi DP, Ribeiro MO, Barbosa LM, Ferreira GEB, Cius A, Zawadzki CH, Portela-Castro ALB. Cytogenetic data on Ancistrus sp. (Siluriformes, Loricariidae) of the Paraguay River basin (MS) sheds light on intrageneric karyotype diversification. Comp Cytogenet . 2016; 10(4):625-36. https://doi.org/10.3897/CompCytogen.v10i4.8532
    » https://doi.org/10.3897/CompCytogen.v10i4.8532
  • Prizon AC, Bruschi DP, Borin-Carvalho LA, Cius A, Barbosa LM, Ruiz HB, Zawadzki CH, Fenocchio AS, Portela-Castro ALB. Hidden diversity in the populations of the armored catfish Ancistrus Kner, 1854 (Loricariidae, Hypostominae) from the Paraná River basin revealed by molecular and cytogenetic data. Front Genet. 2017; 8:185. https://doi.org/10.3389/fgene.2017.00185
    » https://doi.org/10.3389/fgene.2017.00185
  • Rebordinos L, Cross I, Merlo A. High evolutionary dynamism in 5S rDNA of fish: state of the art. Cytogenet Genome Res . 2013; 141(2-3):103-13. https://doi.org/10.1159/000354871
    » https://doi.org/10.1159/000354871
  • Reis RE, Pereira EHL, Armbruster JH. Delturinae, a new loricariid catfish subfamily (Teleostei: Siluriformes), with revisions of Delterus and Hemipsilichthys Zool J Linn Soc . 2006; 147(2):277-99. https://doi.org/10.1111/j.1096-3642.2006.00229.x
    » https://doi.org/10.1111/j.1096-3642.2006.00229.x
  • Reis DAR, Brandão KO, Toledo LFA, Pazza R, Kavalco KF. Localização física dos genes ribossomais 5S e 18S em Ancistrus sp. (Loricariidae: Ancistrini) de Angra dos Reis/RJ, Bacia dos Rios Costeiros. Evol Conserv Biodivers. 2012; 3:39-44.
  • Ribeiro MO, Noleto RB, Lorscheider CA, Porto FE, Prizon AC, Zawadzki CH, Oliveira LC, Portela-Castro ALB. Cytogenetic description of Ancistrus abilhoai (Siluriformes: Loricariidae) from Iguaçu River basin, southern Brazil. Genet Mol Res. 2015; 14(2):4051-57. https://doi.org/10.4238/2015.April.27.20
    » https://doi.org/10.4238/2015.April.27.20
  • Rosa KO, Ziemniczak K, Barros AV, Nogaroto V, Almeida MC, Cestari MM, Artoni RF, Vicari MR. Numeric and structural chromosome polymorphism in Rineloricaria lima (Siluriformes: Loricariidae): fusion points carrying 5S rDNA or telomere sequence vestiges. Rev Fish Biol Fish . 2012; 22:739-49. https://doi.org/10.1007/s11160-011-9250-6
    » https://doi.org/10.1007/s11160-011-9250-6
  • Sambrook J, Russell DW. Molecular cloning, a laboratory manual. New York: Cold Spring Harbor Laboratory Press; 2001.
  • Schemberger MO, Nascimento VD, Coan R, Ramos E, Nogaroto V, Ziemniczak K, Valente GT, Moreira-Filho O, Martins C, Vicari MR. DNA transposon invasion and microsatellite accumulation guide W chromosome differentiation in a Neotropical fish genome. Chromosoma . 2019; 128(4):547-60. https://doi.org/10.1007/s00412-019-00721-9
    » https://doi.org/10.1007/s00412-019-00721-9
  • Sumner AT. A simple technique for demonstrating centromeric heterochromatin. Exp Cell Res. 1972; 75(1):304-06. https://doi.org/10.1016/0014-4827(72)90558-7
    » https://doi.org/10.1016/0014-4827(72)90558-7
  • Traldi JB, Vicari MR, Blanco DR, Martinez JF, Artoni RF, Moreira-Filho O. First karyotype description of Hypostomus iheringii (Regan, 1908): a case of heterochromatic polymorphism. Comp Cytogen. 2012; 6(2):115-25. https://doi.org/10.3897/CompCytogen.v6i2.2595
    » https://doi.org/10.3897/CompCytogen.v6i2.2595
  • Traldi JB, Blanco DR, Vicari MR, Martinez JF, Lui RL, Barros AV, Artoni RF, Moreira-Filho O. Chromosomal diversity in Hypostomus (Siluriformes, Loricariidae) with emphasis on physical mapping of 18S and 5S rDNA sites. Genet Mol Res . 2013; 12(1):463-71. https://doi.org/10.4238/2013.February.8.11
    » https://doi.org/10.4238/2013.February.8.11
  • Vicari MR, Almeida MC, Bertollo LAC, Moreira-Filho O, Artoni RF. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA in the fish Prochilodus lineatus (Characiformes, Prochilodontidae). Genet Mol Biol . 2006; 29:621-25. https://doi.org/10.1590/S1415-47572006000400008
    » https://doi.org/10.1590/S1415-47572006000400008
  • Vicari MR, Nogaroto V, Noleto RB, Cestari, MM, Cioffi MB, Almeida MC, Moreira-Filho O, Bertollo LAC, Artoni RF. Satellite DNA and chromosomes in Neotropical fishes: Methods, applications and perspectives. J Fish Biol . 2010; 76(5):1094-116. https://doi.org/10.1111/j.1095-8649.2010.02564.x
    » https://doi.org/10.1111/j.1095-8649.2010.02564.x
  • Ziemniczak K, Barros AV, Rosa KO, Nogaroto V, Almeida MC, Cestari MM, Moreira-Filho O, Artoni RF, Vicari MR. Comparative cytogenetics of Loricariidae (Actinopterygii: Siluriformes): emphasis in Neoplecostominae and Hypoptopomatinae. Ital J Zool. 2012; 79(4):492-501. https://doi.org/10.1080/11250003.2012.676677
    » https://doi.org/10.1080/11250003.2012.676677

ADDITIONAL NOTES

  • HOW TO CITE THIS ARTICLE

    Glugoski L, Deon G, Schott S, Vicari MR, Nogaroto V, Moreira-Filho O. Comparative cytogenetic analyses in Ancistrus species (Siluriformes: Loricariidae). Neotrop Ichthyol. 2020; 18(2):e200013. https://doi.org/10.1590/1982-0224-2020-0013

Publication Dates

  • Publication in this collection
    26 June 2020
  • Date of issue
    2020

History

  • Received
    13 Mar 2020
  • Accepted
    11 May 2020
Sociedade Brasileira de Ictiologia Universidade Estadual de Maringá, Núcleo de Pesquisas em Limnologia, Ictiologia e Aquicultura/Coleção Ictiologia, Av. Colombo, 5790, 87020-900 Maringá, PR, Brasil, Tel.: (55 44)3011 4632 - Maringá - PR - Brazil
E-mail: neoichth@nupelia.uem.br