Detection and Antimicrobial Resistance Profile of Enteropathogenic (EPEC) and Shigatoxigenic Escherichia coli (STEC) in Conventional and Organic Broiler Chickens

ABSTRACT

Enteropatogenic Escherichia coli (EPEC) and shigatoxigenic E. coli (STEC), are generally poultry and poultry product isolate and can cause serious human infections. Many strains may become resistant to various antimicrobials, which can hinder the treatment of bacterial diseases. Organic farming seeks to avoid the selection and frequency of antimicrobial-resistant bacteria. This study aims to verify the resistance of EPEC and STEC from organic and conventional (industrial) broiler isolates to antimicrobials. All isolates were submitted to disk diffusion test with tetracycline, gentamicin, enrofloxacin, ceftriaxone and amoxicillin + clavulanate (TET, GEN, ENO, CTX, AMC) and PCR to detect specific virulence genes for EPEC and STEC. A total of 297 E. coli strains were isolated, 213 from conventional. In organic broiler, 84 strains were isolated. The strains from the conventional broiler isolates were resistant to five antimicrobials tested: TET 48.82% (104/213), ENO 28.17% (60/213), CTX 15.49% (33/213), GEN 14.55% (31/213), and AMC 7.04% (15/213), and 9.86% (21/213) were considered multidrug-resistant. Organic chicken strains were resistant to four of the antimicrobials tested: TET 35.7% (30/84), ENO 9.5% (8/84), CTX 2.4% (2/84), GEN 4.8% (4/84). Of the strains from the organic broiler chicken isolates, only 1.2% (1/84) was considered multidrug-resistant. No EPEC and STEC were found in the organic chicken samples. The multidrug resistance was characterized in 9.52% (2/21) of the EPEC and 4.76% (1/21) of the STEC. The study demonstrated the absence of EPEC and STEC strains in organic broilers and carcasses and a lower frequency of multiresistant strains compared to conventional breeding.

Keywords:
Antimicrobial-resistant; broilers; Escherichia coli; organic

INTRODUCTION

Escherichia coli is a commensal bacterium that inhabits the intestinal tract of several animal species. Nonetheless, it can acquire virulence attributes that when combined may cause intestinal or extraintestinal clinical syndromes in susceptible individuals (Pakbin et al., 2021). The strain group that causes intestinal diseases in humans, called diarrheagenic, comprises the Enteropathogenic Escherichia coli (EPEC), Enterohemorrhagic Escherichia coli (EHEC), Shigatoxigenic Escherichia coli (STEC), Enteroinvasive Escherichia coli (EIEC), Adherent-invasive Escherichia coli (AIEC), Enterotoxigenic Escherichia coli (ETEC), Diffusely adherent Escherichia coli (DAEC), and Enteroaggregative Escherichia coli (EAEC) pathotypes (Mare et al., 2021).

EPEC and STEC pathotypes are usually poultry and poultry product isolates (Dutta et al. 2011; Alonso et al., 2012; Doregiraee et al. 2016), and are of public health relevance for they can cause enteric diseases in children and adults (Ifeanyi et al., 2016; Fierz et al., 2017; Torres, 2017). Thus, they should be considered in the transmission chain to humans. EPEC strains cause attaching-effacing lesions (A/E lesions) in the intestinal epithelium. This lesion is characterized by the destruction of microvilli, intimate bacterial adherence to the intestinal epithelium, and formation and aggregation of actin and other cytoskeleton components at attachment sites of the bacteria. This injury is mediated by intimin, a protein on the surface of the bacterial cell wall and encoded by the Epithelium attaching-effacing gene (eae gene) (Gomes, Trabulsi, 2008).

The production of Shiga toxin (STX) is the main virulence factor of STEC pathotype strains, leading to direct endothelial damage, with increased production of pro-inflammatory cytokines, thus increasing the risk of thrombosis with injury in multiple organs, mainly kidneys. Intestinal infections generated by these strains may cause Hemolytic Uremic Syndrome (HUS), which is characterized by high morbidity and mortality with neurologic sequelae and chronic hypertension (Derad et al., 2016). Two distinct groups of STX toxin are described, STX1 and STX2, encoded respectively by stx ₁ and stx ₂ genes (Gobius et al., 2003).

Antimicrobials are commonly used to treat various bacterial diseases, however, the use of these drugs in food-producing animals has an impact on the expression of resistance and selection of resistant bacteria. If resistant bacteria develop in a food-producing animal environment, they may be transferred to animals and their products and, thus, to consumers of animal products, such as poultry products. Hence, the growth of antimicrobial resistance from pathogenic bacteria in foods of animal origin, which can occur naturally, usually by genetic alterations (Wall et al., 2016), has become a public health concern. To preserve the effectiveness of antimicrobials used to treat human diseases, several countries have restricted the use of various drugs in food animal production (ECDC, 2015). In Brazil, the use of several antimicrobials as performance-enhancing additives has been banned, but they continue to be used to treat diseases (BRASIL, 2003, 2004, 2005, 2009, 2016, and 2018).

Moreover, besides the legislation restrictions on antimicrobial use in food animal production, consumers concerned about the presence of antimicrobial residues in animal products have opted for organic products. Thus, there has been a worldwide increase in the consumption of organic products (Lima et al., 2020). In addition, under organic systems, free-range broiler chickens should have access to outside areas at least for some time during the day (BRASIL, 2021). This system allows for fiber-rich grasses, regulating the intestinal microbiota, increasing the prevalence of beneficial bacteria, and thus reducing the population of pathogenic bacteria (Zheng et al., 2021).

Hence, this study aimed to compare the frequency of EPEC and STEC E. coli, from conventional and organic broiler chicken isolates, and their antimicrobial resistance profile.

MATERIAL AND METHODS

Material collection

Samples were obtained from six flocks of conventional broiler chickens, bred in an industrial housing, with the use of antibiotics, and two flocks of organic broiler chickens from slaughterhouses inspected by the State Inspection Service (SIE), located in the eastern and southern regions of the state of Rio de Janeiro.

Forty broiler chickens per batch were randomly selected for cloacal material, in a total of five flocks of conventional broiler chickens and two organic broiler chickens at the reception area of each slaughterhouse. The material was collected using swabs that were placed in tubes containing Cary Blair medium (OXOID®). Also, from the same batch, 10 carcasses were randomly selected, removed from the conveyor belt after dripping, and individually packed in sterilized bags. All samples were transported under refrigeration in isothermal boxes.

The experimental protocol agreed with the Ethical Principles in Animal Experiments of the Brazilian Society of Laboratory Animal Science (SBCAL) and was approved by the Ethics Committee on Animal Use of the Federal Fluminense University (CEUA - UFF), under the no. 697.

Conventional bacteriological isolation

The swabs were placed in tubes containing 10 ml of 0.1% peptone saline solution (PSS), and 400 ml of 0.1% PSS were added to the bags containing the carcasses. After the carcasses were washed in PSS for one minute, 10mL of each wash was transferred to sterilized tubes. All samples were incubated at 37°C for 24h. Afterward, the samples were seeded on MacConkey agar (HIMEDIA®) and incubated under the same conditions. From each culture, three colonies with characteristics compatible with E. coli were submitted to biochemical characterization, using Triple Sugar Iron (TSI) agar (PRODIMOL®), Sulfide Indole Motility (SIM) (HIMEDIA®) medium, Methyl Red broth (VM), and VogesProskauer (VP) (MICRO MED®), and Citrate Agar (HIMEDIA®) (MacFaddin 2000).

PCR

All samples identified as E. coli were subjected to DNA extraction by thermal method (Andreatti Filho et al., 2011) for the detection of eae, stx ₁, stx _2, and bfp virulence genes for PCR using pairs of specific primers for each gene (Table 1).

Table 1
Sequence of Oligonucleotide primers and size of the PCR products obtained for the detection of virulence genes of Enteropathogenic and Shigatoxigenic Escherichia coli from broiler chickens.

Oligonucleotide primers	Sequence	Size of PCR products	Reference
eae-F	5’ GACCCGGCACAAGCA TAAGC 3’	384pb	Dutta et al 2011
eae-R	5’ CCACCTGCAGCAACAAGAGG 3’
stx1-F	5’ ATA AATCGCCATTCGTTGACTAC 3’	180pb
stx1-R	5’ AGAACGCCCACTGAGATCATC 3’
stx2-F	5’ GGCACTGTCTGAAACTGCTCC 3’	255pb
stx2-R	5’ TCGCCAGTTATCT GACATTCTG 3’

For the amplification reaction of eae and bpf genes, each 100 ng of DNA extracted in the previous step was added; 1X 10X Buffer; 1.5mM MgCl2; 0.2mM dNTP; 0.4 µM of each primer (Table 1); 1U of Taq Polymerase, totaling a final volume of 25 µL.

In the reaction for the detection of stx ₁ and stx ₂ genes, 1X of 10X Buffer was added to each 100 ng of extracted DNA; 2mM MgCl2; 0.4mM dNTP; 0.4µM of each primer (Table 1); 1U of Taq Polymerase, totaling a final volume of 25 µL.

Amplification was conducted in a thermocycler (Programmable Thermal Controller PTC-100) under the following conditions: denaturation at 94°C for 5 minutes, 30 cycles of 94°C for 45 seconds, 59°C for 45 seconds, 72°C for one minute, and a final extension at 72°C for 6 minutes (Dutta, 2011).

Disk Diffusion Test

The disk diffusion test was performed for phenotypic evaluation of resistance to antimicrobials of the classes: tetracyclines (tetracycline - TET 30), aminoglycosides (gentamicin - GEN 10), quinolones (enrofloxacin - ENO 05), cephalosporins (ceftriaxone - CTX 05) and penicillins (amoxicillin + clavulanate - AMC 30) (CLSI, 2022). Multidrug-resistant strains were those with resistance to three or more classes of antimicrobials (Magiorakos et al., 2012).

Statistical analysis

Chi-square and Fisher’s exact tests were used, when needed, with a significance level of 0.05 for the comparison of contamination sources.

RESULTS AND DISCUSSION

A total of 297 E. coli strains were isolated, 213 from conventional broiler chickens, of which 106 were cloaca isolates and 107 carcass isolates. Of the organic broiler chickens, 84 strains were isolated, 52 cloaca isolates, and 32 carcass isolates.

EPEC and STEC Characterization

Of the 213 strains isolated from conventional broiler chickens, 26.76% (57/213) were characterized as EPEC, since they harbor only the eae gene (Gomes; Trabulsi, 2008), and 16.43% (35/213) as STEC (Table 2), for they carry stx ₁ and/or stx ₂ genes (Gobius et al., 2003). Moreover, the frequency of these diarrheagenic strains in poultry or carcasses was higher than that found in other studies. Hence, EPEC strains continue to be the most prevalent when compared to STEC strains (Dutta et al., 2011; Alonso et al., 2012; Samanta et al., 2015; Badi et al., 2018; Cerutti et al., 2020; Shen et al., 2022), which was corroborated by the same reports. Nonetheless, this differs from reports by Nagwa et al., (2022), where 30% of STEC and 10% of EPEC were found.

Table 2
Distribution of diarrheagenic E. coli strains of the Enteropathogenic (EPEC) and Shigatoxigenic (STEC) pathotypes isolated from cloacal material and conventional and organic chicken carcasses.

Pathotype	Conventional			Organic
	Source		Total	Source		Total
	Cloaca	Carcasse		Cloaca	Carcasse
EPEC	30 (52,63%)	27 (47,37%)	57 (100%)	0	0	0
STEC	16 (45,71%)	19 (54,29%)	35 (100%)	0	0	0
No EPEC/STEC	60 (49,59%)	61 (50,41%)	121 (100%)	52 (61,90%)	32 (38,10%)	84 (100%)

In broiler chickens and carcasses from organic farming, no EPEC or STEC strains were detected. Access to pasture, one of the characteristics adopted by the organic system, may promote fiber intake, which regulates the intestinal microbiota, thus increasing the prevalence of beneficial bacteria, and reducing the population of pathogenic bacteria (Zheng et al., 2021). Also, antimicrobials used in conventional farming can unbalance the intestinal microbiota. In the absence of these drugs, as seen in organic farming, the microbiota can be more balanced, enabling competitive exclusion of pathogenic bacteria that coexist in the same environment (Praxedes et al., 2012).

Among the analyzed sources, the EPEC strains were more frequent in the cloacal material, detected in 52.63% (30/57) of the strains, and in the carcasses in 47.37% (27/57). Among the STEC strains, there was a higher frequency of strains in carcasses, detected in 54.29% (19/35) of the strains. In the cloacal samples, 45.71% (16/35) of STEC strains were isolates. There was no statistical difference between the cloacal and carcass sources, still, the Fisher’s test showed a significant difference (p=0.0099) between the frequencies of EPEC and STEC strains (Table 2). Also, in a study using the same sources, Alonso et al. (2012) detected a higher percentage of EPEC strains in cloacal samples (11.9% -102/859) compared to STEC strains in the same source (0.1% - 1/ 859). In carcasses, the same authors reported a frequency of 3.9% (18/457) of EPEC strains and 3.3% (15/457) of STEC strains. According to the same authors, contamination of carcasses may result from cross-contamination during slaughter from strains of the intestinal tract of poultry, and, therefore, adopting hygienic practices during slaughter so as to provide consumers with a safe product is paramount.

Despite the detected pathotypes and their frequencies, both are of great public health concern, for they are responsible for enteric diseases in humans (Blanco et al., 2006; Rasko et al., 2011).

Antimicrobial resistance

Strains isolated from conventional broiler chickens were resistant to the five antimicrobials tested, in the following frequency: TET 48.82% (104/213), ENO 28.17% (60/213), CTX 15.49% (33/213), GEN 14.55% (31/213), and AMC 7.04% (15/213). Strains from organic broiler chickens were resistant to four of the antimicrobials tested, in the following frequency: TET 35.7% (30/84), ENO 9.5% (8/84), CTX 2.4% (2/84), and GEN 4.8% (4/84). In the strains from organic broiler chickens, all strains were sensitive to AMC (Table 3). All samples had a statistically significant difference in the chi-square test (p<0.05). The ban on the use of antimicrobials during all stages of production may account for the lower number of resistant strains in organic broiler chickens (BRASIL, 2007). Wall et al. (2016) reported that the use of these drugs in food-producing animals can select resistant strains and increase their frequency in these animals. Macedo et al. (2013) described in their study a higher frequency of resistant bacteria in the carcasses of conventional broiler chickens when compared to those of organic broiler chickens. However, Millman et al. (2013) observed a greater number of drugs to which E. coli strains were resistant in samples from organic broiler chickens (13/14) compared to those from conventional broiler chickens (9/14), despite no significant difference.

Table 3
Resistance Profile of Escherichia coli chicken isolates and cloacal material, and conventional and organic broiler chicken carcasses.

Antibiotics	Conventional	Organic
TET	104 a (48,82%)	30 b (35,7%)
ENO	60 a (28,17%)	8 b(9,5%)
CTX	33 a(15,49%)	2 b(2,4%)
GEN	31 a(14,55%)	4 b(4,8%)
AMC	15 a(7,04%)	0 b

• TET = Tetracycline; ENO = Enrofloxacin; CTX = Ceftriaxone; GEN = Gentamicin; AMC = Amoxicillin + clavulanate. Different letters on the line indicate significant difference (p<0,05).

In the present study, E. coli strains, isolated from conventional and organic broilers, showed high percentages of resistance to tetracycline (35.02% - 134/297) and to enrofloxacin (22.89% - 68/297). Cardoso et al. (2015) found higher percentages of resistance to the same antimicrobials. However, this was already expected as these antibiotics are widely used in poultry production and can be easily purchased.

In the strains from the conventional broiler chickens, 9.86% (21/213) were resistant to three or more classes of antimicrobials, being considered multi-resistant. In the strains isolated from the organic broiler chickens, only 1.2% (1/84) were considered multidrug-resistant. Statistically, the chi-square test showed a significant difference (p<0.05) among the analyzed samples. Similar data, in which the occurrence of multidrug resistance is lower in organic creations compared to conventional ones, were also obtained by Vieira et al. (2022). Taking into account the legal restrictions on the use of these drugs in organic farming, this result was already expected, for the absence of antimicrobials in this organic system ends up developing less selection pressure for resistant strains.

Antimicrobial multidrug resistance in diarrheagenic EPEC and STEC strains

Among the diarrheagenic strains isolated from conventional broiler chickens considered multidrug-resistant, 9.52% (2/21) were of the EPEC pathotype and 4.76% (1/21) of the STEC pathotype. Furthermore, Fisher’s exact test showed no statistical difference among the samples (p>0.05). Infections caused by E. coli from EPEC and STEC pathotypes may require antimicrobial treatment in severe cases in humans (Wong et al., 2012, Ifeanyi et al, 2016, Canizalez-Roman et al., 2016). Yet, the presence of multidrug-resistant strains, such as those detected in this study, may be the cause of treatment failures when using these drugs.

CONCLUSION

This study allowed characterizing the presence of strains of the EPEC and STEC pathotypes only in cloacal samples and carcasses of conventional creation broilers, with the EPEC pathotype being the most frequent. In these strains, the multidrug resistance phenotype was also characterized, which may constitute an additional risk, as this condition can lead to failures in therapies against infections caused by these pathotypes.

REFERENCES

• Alonso MZ, Lucchesi PMA, Rodríguez EM, et al. Enteropathogenic (EPEC) and Shigatoxigenic Escherichia coli (STEC) in broiler chickens and derived products at different retail stores. Food Control 2012;23:351-5. https://doi.org/10.1016/j.foodcont.2011.07.030
  » https://doi.org/10.1016/j.foodcont.2011.07.030
• Andreatti Filho RL, Gonçalves GAM, Okamoto AS, et al. Comparação de métodos para extração de dna na reação em cadeia da polimerase para detecção de Salmonella Enterica sorovar enteritidis em produtos avícolas. Ciência Animal Brasileira 2011;12(1):115-9.
• Badi S, Cremonesi P, Abbassi MS, et al. Antibiotic resistance phenotypes and virulence-associated genes in Escherichia coli isolated from animals and animal food products in Tunisia. FEMS Microbiology Letters 2018;1(10):365. https://doi.org/10.1093/femsle/fny088
  » https://doi.org/10.1093/femsle/fny088
• Bampi J, Bampi M, Biasotto A, et al. Análise cloacal e comparação de microbiota de galinhas caipiras e frangos de granja. RAMVI, Getúlio Vargas 2015;2(3):1-14.
• Blanco M, Blanco JE, Dahbi G, et al. Typing of intimin (eae) genes from enteropathogenic Escherichia coli (EPEC) isolated from children with diarrhoea in Montevideo, Uruguay: identification of two novel intimin variants (mB and jR/b2B) Journal of Medical Microbiology 2006;55:1165-74. https://doi.org/10.1099/jmm.0.46518-0
  » https://doi.org/10.1099/jmm.0.46518-0
• Brasil. Ministério da Agricultura Pecuária Abastecimento. Instrução Normativa n° 35 de 14 de novembro de 2005. Proíbe a fabricação, a importação, a comercialização e o uso de produtos destinados à alimentação animal contendo a substância química denominada Carbadox; 2005 [cited 2021 Mar 13]. Disponível em: http://sistemasweb. agricultura.gov.br/sislegis/action/detalhaAto.do?method=gravarAtoPDF&tipo=INM&numeroAto=00000035&seqAto=000&valorAno=2005&orgao=SDA/MAPA&codTipo=&desItem=&desItemFim=.
• Brasil. Ministério da Agricultura Pecuária e Abastecimento. Instrução normativa n° 5 de 22 de novembro de 2016 Uso de substância antimicrobiana em rações animais é proibido. DOU 2016;229:6 [cited 2018 Feb]. Available from: http://www.agricultura.gov.br/assuntos/insumos-agropecuarios/insumos-pecuarios/alimentacao-animal/arquivos-alimentacao-animal/legislacao/instrucao-normativa-no-45-de-22-de-novembro-de-2016.pdf/view
  » http://www.agricultura.gov.br/assuntos/insumos-agropecuarios/insumos-pecuarios/alimentacao-animal/arquivos-alimentacao-animal/legislacao/instrucao-normativa-no-45-de-22-de-novembro-de-2016.pdf/view
• Brasil. Ministério da Agricultura, Pecuária e Abastecimento. Instrução Normativa nº 9, de 27 de junho de 2003. Proíbe a fabricação, a manipulação, o fracionamento, a comercialização, a importação e o uso dos princípios ativos cloranfenicol, nitrofuranos e os produtos que contenham estes princípios ativos, para uso veterinário e suscetível de emprego na alimentação de todos os animais e insetos. 2003 [cited 2021 Mar 13]. Available from: http://sistemasweb.agricultura.gov.br/sislegis/action/detalhaAto.do?method=gravarAtoPDF&tipo=INM&numeroAto=00000009&seqAto=000&valorAno=2003&orgao=MAA&codTipo=&desItem=&desItemFim=.
  » http://sistemasweb.agricultura.gov.br/sislegis/action/detalhaAto.do?method=gravarAtoPDF&tipo=INM&numeroAto=00000009&seqAto=000&valorAno=2003&orgao=MAA&codTipo=&desItem=&desItemFim
• Brasil. Ministério da Agricultura, Pecuária e Abastecimento. Instrução Normativa nº 11, de 24 de novembro de 2004. Proíbe a fabricação, a importação, a comercialização e o uso da substância química denominada Olaquindox, como aditivo promotor de crescimento em animais produtores de alimentos. 2004 [cited 2021 Mar 13]. Available from: http://sistemasweb.agricultura.gov.br/ sislegis/action/detalhaAto.do?method=gravarAtoPDF&tipo=INM&numeroAto=00000011&seqAto=000&valorAno=2004&orgao=SARC/MAA&codTipo=&desItem=&desItemFim=
  » http://sistemasweb.agricultura.gov.br/ sislegis/action/detalhaAto.do?method=gravarAtoPDF&tipo=INM&numeroAto=00000011&seqAto=000&valorAno=2004&orgao=SARC/MAA&codTipo=&desItem=&desItemFim=
• Brasil. Ministério da Agricultura, Pecuária e Abastecimento. Decreto N° 6323 de 27 de dezembro de 2007. As atividades pertinentes ao desenvolvimento da agricultura orgânica. 2007 [cited 2021 Mar 13]. Available from: http://www.planalto.gov.br/ccivil_03/_ato2007-2010/2007/Decreto/D6323.htm
  » http://www.planalto.gov.br/ccivil_03/_ato2007-2010/2007/Decreto/D6323.htm
• Brasil. Ministério da Agricultura, Pecuária e Abastecimento. Instrução Normativa nº26 de 09 de julho de 2009. Aprova o Regulamento Técnico para a fabricação, o controle de qualidade, a comercialização e o emprego de produtos antimicrobianos de uso veterinário. 2009 [cited 2022 Mar 15]. Available from: http://sistemasweb.agricultura.gov.br/sislegis/action/detalhaAto.do?method=consultarLegislacaoFederal
  » http://sistemasweb.agricultura.gov.br/sislegis/action/detalhaAto.do?method=consultarLegislacaoFederal
• Brasil. Ministério da Agricultura, Pecuária E Abastecimento. Portaria n° 171 de dezembro de 2018. Informa sobre a intensão de proibição de uso de antimicrobianos com a finalidade de aditivos melhoradores de desempenho de alimentos e abre prazo manifestação. 2018 [cited 2022 Ago 15]. Available from: http://sistemasweb.agricultura.gov.br/sislegis/action/detalhaAto.do?method=consultarLegislacaoFederal
  » http://sistemasweb.agricultura.gov.br/sislegis/action/detalhaAto.do?method=consultarLegislacaoFederal
• Brasil. Ministério da Agricultura, Pecuária e Abastecimento. Portaria nº 52, de 15 de março de 2021. Estabelece o regulamento técnico para os sistemas orgânicos de produção e as listas de substâncias e práticas para o uso nos sistemas orgânicos de produção. DOU 2021; ed.5, Seção: 1, p.10, 23 de março de 2021. Available from: https://pesquisa.in.gov.br/imprensa/jsp/visualiza/index.jsp?data=23/03/2021&jornal=515&pagina=10
  » https://pesquisa.in.gov.br/imprensa/jsp/visualiza/index.jsp?data=23/03/2021&jornal=515&pagina=10
• Canizalez-Roman A, Flores-Villaseñor HM, Gonzalez-Nuñez E, et al. Surveillance of diarrheagenic Escherichia coli strains isolated from diarrhea cases from children, adults and elderly at northwest of Mexico. Frontiers in Microbiology 2016;7:1-11. https://doi.org/ 10.3389/fmicb.2016.01924.
  » https://doi.org/
• Cerutti MF, Vieira TR, Zenato KS, et al. Escherichia coli in chicken carcasses in southern Brazil: absence of shigatoxigenic (STEC) and isolation of atypical enteropathogenic (aEPEC). Brazilian Journal of Poultry Science 2020;22(5). https://doi.org/10.1590/1806-9061-2019-1093
  » https://doi.org/10.1590/1806-9061-2019-1093
• CLSI - Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. Wayne; 2022. p.362.
• Derad I, Obermann B, Katalinic A, et al. Hypertension and mild chronic kidney disease persist following severe haemolytic uraemic syndrome caused by Shiga toxin-producing Escherichia coli O104:H4 in adults. Nephrology Diálise Transplantation 2016;31(1):95-103. https://doi.org/ 10.1093/ndt/gfv255.
  » https://doi.org/
• Dominguez JE, Redondo LM, Espinosa RAF, et al. Simultaneous carriage of mcr-1 and other antimicrobial resistance determinants in Escherichia coli from poultry. Frontiers in Microbiology 2018;9:1679. https://doi.org/10.3389/fmicb.2018.01679
  » https://doi.org/10.3389/fmicb.2018.01679
• Doregiraee F, Alebouyeh M, Fasaei NB, et al. Isolation of atypical enteropathogenic and shiga toxin encoding Escherichia coli strains from poultry in Tehran. Gastroenterology and Hepatology From Bed to Bench 2016;9(1):53-7.
• Dutta TK, Roychoudhury P, Bandyopadhyay S, et al. Detection and characterization of Shiga toxin producing Escherichia coli (STEC) and enteropathogenic Escherichia coli (EPEC) in poultry birds with diarrhoea. Indian Journal of Medical Research 2011;133:541-5.
• ECDC - European Centre for Disease Prevention. ECDC/EFSA/EMA first joint report on the integrated analysis of the consumption of antimicrobial agents and occurrence of antimicrobial resistance in bacteria from humans and food-producing animals. EFSA Journal 2015;13(1):4006 https://doi.or/10.2903/j.efsa.2015.4006
  » https://doi.or/10.2903/j.efsa.2015.4006
• Fierz L, Cernela N, Hauser E, et al. Characteristics of shigatoxin-producing escherichia coli strains isolated during 2010-2014 from human infections in Switzerland. Frontiers in Microbiology 2017;8:1471. https://doi.org/10.3389/fmicb.2017.01471
  » https://doi.org/10.3389/fmicb.2017.01471
• Gobius KS, Higgs GM, Desmarchelier PM. Presence of activatable shiga toxin genotype (stx2d) in shiga toxigenic Escherichia coli from livestock sources. Journal of Clinical Microbiology 2003;41(8):3777-83. https://doi.org/ 10.1128/JCM.41.8.3777-3783.2003
  » https://doi.org/
• Gomes TAT, Trabulsi LR. Escherichia coli enteropatogênica (EPEC). In: Trabulsi LR, Alterthum F. editors. Microbiologia. 5th ed. São Paulo: Atheneu; 2008. p.281-7.
• Ifeanyi CIC, Ikeneche NF, Bassey BE, et al. Molecular and phenotypic typing of enteropathogenic Escherichia coli isolated in childhood acute diarrhoea in Abuja, Nigeria. Journal of Infection in Developing Countries 2016;11(7):527-35. https://doi.org/10.3855/jidc.9338
  » https://doi.org/10.3855/jidc.9338
• Kilonzo-Nthenge A, Nahashon SN, Chen F, et al. Prevalence and antimicrobial resistance of pathogenic bacteria in chicken and guinea fowl. Poultry Science 2008;87(9):1841-8. https://org.doi/10.3382/ps.2007-00156
  » https://org.doi/10.3382/ps.2007-00156
• Krumperman PH. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of faecal contamination of foods. Applied Environmental Microbiology 1983;46(1):165-70.
• Lima SK, Galiza M, Valadares AA, et al. Produção e consumo de produtos orgânicos no mundo e no Brasil. 2020 [cited 2022 Ago 15]. Available from: https://repositorio.ipea.gov.br/bitstream/11058/9678/1/TD_2538.pdf
  » https://repositorio.ipea.gov.br/bitstream/11058/9678/1/TD_2538.pdf
• Macedo RF, Rossa LS, Stahlke EVR, et al. Resistência antimicrobiana e ocorrência de micro-organismos patogênicos e indicadores em frangos orgânicos e convencionais: estudo comparativo. Biotemas 2013;26 (3): 211-220.
• MacFaddin JF. Biochemical tests for identification of medical bacteria. 3rd ed. Baltimore: Lippincott Williams e Wilkins; 2000.
• Magiorakos AP, Srinivasan A, Carey RB, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clinical Microbiology and Infection 2012;18(3):268-81. http://dx.doi.org/10.1111/j.1469-0691.2011.03570.x
  » http://dx.doi.org/10.1111/j.1469-0691.2011.03570.x
• Mare AD, Ciurea CN, Man A, et al. Enteropathogenic Escherichia coli - a summary of the literature. Gastroenterology 2021;12:28-40. https://doi.org/10.3390/gastroent 12010004.
  » https://doi.org/10.3390/gastroent
• Millman JM, Waits K, Grande H, et al. Prevalence of antibiotic-resistant E. coli in retail chicken: comparing conventional, organic, kosher, and raised without antibiotics. F1000Research 2013;11(2):155. https://org.doi/10.12688/f1000research.2-155.v2
  » https://org.doi/10.12688/f1000research.2-155.v2
• Pakbin B, Brück WM, Rossen JWA. Virulence factors of enteric pathogenic Escherichia coli: a review. International Journal of Molecular Science 2021.;22(18):9922. https://doi.org/10.3390/ijms22189922
  » https://doi.org/10.3390/ijms22189922
• Praxedes CIS, Zúniga NOC, Bastos PAMB, et al. Identificação de Enterobacteriaceae da microbiota intestinal de frangos de corte submetidos a dieta com nitrofuranos. Revista Brasileira de Medicina Veterinária 2012;19(1):46-9.https://doi.org/ http://dx.doi.org/10.4322/rbcv.2014.073
  » https://doi.org/
• Rasko DA, Webster DR, Sahl JW, et al. Origins of the E.coli strain causing an outbreak of hemolytic-uremic syndrome in germany. New England Journal of Medicine 2011;365(8):709-17.https://doi.org/10.1056/NEJMoa1106920
  » https://doi.org/10.1056/NEJMoa1106920
• Samanta I, Joardar SN, Das PK, et al. Comparative possession of Shiga toxin, intimin, enterohaemolysin and major extended spectrum beta lactamase (ESBL) genes in Escherichia coli isolated from backyard and farmed poultry. Iranian Journal of Veterinary Research 2015;16(1):90-3.
• Shen J, Zhi S, Guo D, et al. Prevalence, antimicrobial resistance, and whole genome sequencing analysis of shiga toxin-producing Escherichia coli (STEC) and Enteropathogenic Escherichia coli (EPEC) from Imported Foods in China during 2015-2021. Toxins 2022;14(2):68. https://doi.org/10.3390/toxins14020068
  » https://doi.org/10.3390/toxins14020068
• Torres AG. Escherichia coli diseases in Latin America - a 'One Health' multidisciplinary approach. Pathogens and Disease 2017;75(2):1-7. https://doi.org/10.1093/femspd/ftx012
  » https://doi.org/10.1093/femspd/ftx012
• USDA - United States Departament of Agriculture. Food safety and inspection service. isolation and identification of salmonella from meat, poultry, pasteurized egg, and siluriformes (fish) products and carcass and environmental sponges [Method 4.09]. 1998 [cited 2022 Ago 15]. Available from: https://www.fsis.usda.gov/wps/wcm/connect/700c05fe-06a2-492a-a6e1-3357f7701f52/MLG-4.pdf?MOD=AJPERES
  » https://www.fsis.usda.gov/wps/wcm/connect/700c05fe-06a2-492a-a6e1-3357f7701f52/MLG-4.pdf?MOD=AJPERES
• Vieira TR, Oliveira EC, Cibulski SP, et al. Antimicrobial resistance profiles in Escherichia coli isolated from whole-chicken carcasses from conventional, antibiotic-free, and organic rearing systems. Semina 2022;43(2):2093-108.
• Wall BA, Mateus A, Marshall L, et al. Drivers, dynamics and epidemiology of antimicrobial resistance in animal production. Rome: FAO; 2016 [cited 2022 Mar 15]. Available from: https://www.fao.org/3/i6209e/i6209e.pdf.
• Wong CS, Mooney JC, Brandt JR, et al. Risk factors for the hemolytic uremic syndrome in children infected with Escherichia coli O157:H7: a multivariable analysis. Clinical Infectious Diseases 2012; 55(1):33-41. https://doi.org/10.1093/cid/cis299
  » https://doi.org/10.1093/cid/cis299
• Zheng M, Mao P, Tian X, et al. Effects of grazing mixed-grass pastures on growth performance, immune responses, and intestinal microbiota in free-range Beijing-you chickens. Poultry Science 2021;100(2):1049-58. https://doi.org/10.1016/j.psj.2020.11.005
  » https://doi.org/10.1016/j.psj.2020.11.005

Publication Dates

• Publication in this collection
  21 Aug 2023
• Date of issue
  2023

History

• Received
  19 Dec 2022
• Accepted
  11 July 2023