Purified lignin supplementation on the performance and antioxidant status of broilers subjected to cyclic heat stress

ABSTRACT

The objective of this study was to evaluate the effects of dietary supplementation of purified lignin on the performance, relative organ weights, serum metabolites, and gene expression profiles of broiler chickens subjected to cyclic heat stress (HS). At 22 days old, 280 broilers were distributed in a completely randomized design with four treatments, ten repetitions, and seven birds per experimental unit. The birds were subjected to daily cyclic HS. A high temperature of 32±1 °C was maintained for 10 h/day (08:00–18:00 h), while a temperature of 22±1 °C was maintained for the remaining time. Treatments were a basal diet or basal diet with the addition of 5, 10, or 15 g of purified lignin/kg of diet. Data were analyzed using one-way ANOVA and means were compared by Tukey's test at 0.05 significance. There was no effect of lignin supplementation on performance, carcass yield, relative weights of the bursa, spleen, and liver, or serum levels of glucose, triglycerides, uric acid, malondialdehyde, triiodothyronine, or tetraiodothyronine. The abundance of mRNA of heat shock protein 70, nuclear factor-κB, glutathione peroxidase, and Cu,Zn-superoxide dismutase in the liver was similarly unaffected by treatments. Purified lignin supplementation does not improve performance or the antioxidant response of broiler chickens subjected to HS.

Keywords:
performance; phenolic compounds; poultry

1. Introduction

Heat stress (HS) is a critical problem in broiler production in hot-climate areas, triggering significant economic losses. This condition results from a negative balance between the net energy flowing from the animal's body to its surrounding environment and the amount of heat energy produced by the animal (Lara and Rostagno, 2013). In general, various combinations of factors related to the thermal environment and animal characteristics can trigger this imbalance.

Heat stress can influence performance (Hamidi et al., 2022), immune responses (Hirakawa et al., 2020), and cellular antioxidant system (Habashy et al., 2018; Surai et al., 2019) of broiler chickens. In addition to the utilization of ventilation and cooling systems, nutritional manipulations have been suggested as an alternative to decrease the detrimental impacts of HS on poultry performance and the antioxidant system. Dietary supplementation with polyphenol curcumin improved final body weight, decreased mitochondrial malondialdehyde (MDA) concentration, and enhanced mitochondrial gene expression of superoxide dismutase in broiler chickens subjected to HS (Zhang et al., 2018).

Lignin is a polyphenolic polymer naturally occurring in the cell walls of plants (Vance et al., 1980). In animal nutrition, lignin is mostly regarded as a barrier to nutrient digestibility. Incidentally, in the paper-making industry, purified lignin is recovered as a byproduct of cellulose production after various processes (sulfite, kraft, or alcell). In its purified form, lignin contains several low-molecular-weight phenolic monomers, such as carvacrol and cinnamaldehyde, that possess biological effects not characteristic of native lignin (Bozin et al., 2006; Baurhoo et al., 2007a). Studies have investigated the benefits of these phenolic monomers on the production and health of broilers (Bosetti et al., 2020; Galli et al., 2020), but less research has utilized purified lignin.

In this study, we hypothesized that dietary supplementation of purified lignin can improve performance and the antioxidant responses of broiler chickens subjected to HS. Therefore, we evaluated the effects of dietary supplementation of purified lignin on the performance, relative organ weights, serum metabolites, and gene expression profiles of broiler chickens subjected to cyclic HS.

2. Material and Methods

2.1. Ethical matters

The Institutional Animal Care and Use Committee approved all animal handling procedures (case number 038/2020), and the experiment was conducted according to the experimental protocol for the use of live birds from the Brazilian College of Animal Experimentation.

2.2. Birds, experimental design, and diets

The experiment was conducted in Viçosa, MG, Brazil (20°45'57.19" S, 42°51'35.42" W, and 682 m altitude). The male broiler chickens (Cobb 500) used in the experiment were obtained from a commercial hatchery (Rivelli Alimentos SA, Matheus Leme, MG, Brazil). Chicks were vaccinated against bursal disease and Marek's disease (Serotype 3, Live Marek's Disease Vector, Merial Inc., Athens, GA). From one day old until the beginning of the experiment, the birds were reared in a masonry house divided into protected circular pens containing tube feeders, manual drinkers, and a litter of wood shavings. They had free access to water and were fed ad libitum with a corn/soybean meal-based mash diet formulated to meet their nutritional requirements according to Rostagno et al. (2017).

At 22 days old, 280 broiler chickens (983±38 g) were distributed based on body weight in a completely randomized design with four treatments, ten repetitions, and seven birds per experimental unit. They were housed in 40 wire floor cages (1,008 cm²/bird) in a four-level battery equipped with a trough feeder and a nipple drinker.

Birds were subjected to daily cyclic HS in controlled chambers. A high temperature of 32±1 °C was maintained for 10 h/day (08:00–18:00 h), while the temperature was set at 22±1 °C for the remaining time. The relative humidity of the air inside the chambers was maintained at 65±5%.

Treatments were a basal diet or basal diet with the addition of 5, 10, or 15 g of purified lignin/kg of diet. The purified lignin used in this research was extracted from Eucalyptus urograndis through the kraft process, used in pulp and paper production. The corn/soybean meal basal diet was formulated to meet the nutritional recommendations given by Rostagno et al. (2017) (Table 1). Purified lignin in the basal diet was used instead of the inert. Diets were prepared in mash form. Free access to water and feed was provided throughout the experimental period (22 to 42 days old). The light program adopted for the entire experimental period was 18 h of light (4:00 to 22:00 h) and 6 h of dark.

Table 1
Ingredients and nutrient composition of basal diet (as-fed basis)

Ingredient (g/kg)		22-42 days of age
	Corn (78.6 g/kg)	568.2
	Soybean meal (450 g/kg)	322.5
	Soybean oil	60.95
	Dicalcium phosphate	13.28
	Limestone	6.86
	Salt	4.81
	DL-Methionine (999 g/kg)	2.71
	L-Lysine HCl (780 g/kg)	1.92
	Vitamin premix1	1.20
	Trace mineral premix2	1.00
	Choline chloride (600 g/kg)	0.80
	L-Threonine (985 g/kg)	0.54
	L-Valine (990 g/kg)	0.24
	Inert	15.00
Calculated composition (g/kg, unless shown)
	Metabolizable energy (kcal/kg)	3,200
	Crude protein	195.0
	Calcium	7.05
	Available phosphorus	3.41
	Sodium	2.03
	Digestible glycine + serine	15.52
	Digestible lysine	10.77
	Digestible methionine + cysteine	7.97
	Digestible valine	8.29
	Digestible threonine	7.11
	Digestible thyptophan	2.18

• ¹
  Vitamin premix provided per kg of diet: vitamin A, 11,566 IU; vitamin D3, 2,892 IU; vitamin E, 43.3 IU; vitamin K3, 2.32 mg; vitamin B1, 3.12 mg; vitamin B12, 0.019 mg; vitamin B6, 4.33 mg; vitamin B5, 15.54 mg; vitamin B3, 47.0 mg; vitamin B9, 1.08 mg; biotin, 0.11 mg.
• ²
  Trace mineral premix provided per kg of diet: Mn, 58.36 mg; Zn, 54.21 mg; Fe, 41.68 mg; Cu, 8.31 mg; I, 0.843 mg; Se, 0.250 mg.

2.3. Performance and sample collection

Birds and feed leftovers were weighed at 42 days of age to calculate feed intake (FI), weight gain (WG), and feed conversion ratio (FCR). Mortalities were recorded throughout the experimental period, and the necessary corrections of performance data were carried out.

At 42 days old, three birds with weights closest to the average weight for their respective experimental unit were selected. One bird was used for blood collection. After blood collection, the bird was euthanized by cervical displacement and slaughtered. Liver samples were collected, stored individually in cryogenic tubes, and placed in liquid nitrogen. These samples were transferred to freezer storage at −80 °C until the RNA extraction process.

The two remaining birds, after 8 h of fasting, were euthanized by cervical displacement and slaughtered to measure the yield of carcass, breast, and thigh with drumstick, as well as the relative weight of the lymphoid organs (bursa and spleen), liver, intestine, and abdominal fat. Carcass yield (CY) was calculated in relation to living weight before slaughter [%CY = (carcass weight × 100)/live weight] and breast and thigh yield with drumstick, and as a function of carcass weight [%Part = (part weight × 100)/carcass weight]. The relative weights of the bursa, spleen, liver, intestine, and abdominal fat were calculated in relation to the live weight of the birds before slaughter.

2.4. Serum parameter measurement

The collected blood was used to analyze serum levels of glucose, uric acid, triglycerides (Cobas c 311; Roche Diagnostics GmbH, Basel, Switzerland), and the hormones triiodothyronine (T3) and tetraiodothyronine (T4; Atellica IM, Siemens Healthcare Diagnostics Inc, New York, USA), following the manufacturer's instructions. To measure MDA, 2.5 mL of 20% trichloroacetic acid and 1.0 mL of 0.67% thiobarbituric acid were added to 0.5 mL of serum; the mixture was then heated for 30 min in boiling water. The resulting chromogen was extracted with 4.0 mL of n-butyl alcohol. The absorbance of the organic phase was determined at a wavelength of 530 nm.

2.5. Total RNA extraction, cDNA synthesis, and RT-qPCR analysis

Total RNA was extracted from 50 mg of powdered liver samples, using TRIzol^® (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The resulting precipitate was rehydrated with 25 μL of UltraPure DNase/RNase-Free water. The RNA concentration was estimated using a NanoDrop^TM Lite Spectrophotometer (ThermoFisher Scientific, Beverly, MA, USA). RNA integrity was determined in 1.0% agarose gel. The first cDNA strand was synthesized using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Thermo Fisher Scientific, Beverly, MA, USA). The primer sets used are shown in Table 2; β-actin (β-ACT) was used as the reference gene for data normalization. The following target genes were assessed: heat shock protein 70 (HSP70), nuclear factor-κB (NF-κB), glutathione peroxidase (GPX), and Cu,Zn-superoxide dismutase (SOD1).

Table 2
Primer sequences

Gene	Forward sequence	Reverse sequence
HSP70	CACCATCACTGGCCTTAACGT	TTATCCAAGCCATAGGCAATAGC
NF-κB	GTGTGAAGAAACGGGAACTG	GGCACGGTTGTCATAGATGG
GPX	GACCAACCCGCAGTACATCA	GAGGTGCGGGCTTTCCTTTA
SOD1	AGGGGGTCATCCACTTCC	CCCATTTGTGTTGTCTCCAA
β-actin	TGCTGTGTTCCCATCTATCG	TTGGTGACAATACCGTGTTCA

• HSP70 - heat shock protein 70; NF-κB - nuclear factor-κB; GPX - glutathione peroxidase; SOD1 - Cu,Zn-superoxide dismutase.

The RT-qPCR analyses were performed in duplicate with an Applied Biosystems^TM QuantStudio Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Beverly, MA, USA), using the Relative Quantification method and applying the SYBR^® Green system (Applied Biosystems, Foster City, CA, USA) and GoTaq^® qPCR Master Mix kit (Promega Corporation, Madison, WI, USA). PCR reactions were subjected to the cycles protocol according to the program: 95 °C for 2 min, 40 cycles of 95 °C for 15 s, and 60 °C for 1 min. Threshold cycle (Ct) values obtained were later normalized (ΔCt) based on Ct values of the endogenous control gene β-ACT. The calculation of gene expression levels was performed according to the 2^-ΔCt method, as described by Livak and Schmittgen (2001).

2.6. Statistical analysis

Cage averages were considered as an experimental unit for statistical analysis of growth performance parameters. For analyses of yield of carcass, breast, and thigh with drumstick, as well as the relative weights of the lymphoid organs, liver, intestine, and abdominal fat, the average of two birds per replicate was considered as the experimental unit. For serum and gene expression analyses, one bird per replicate was considered as the experimental unit. Data were analyzed via one-way ANOVA, according to the following general model:

$${\text{Y}}_{\text{ij}}=\mu +{\alpha }_{\text{i}}+{\epsilon }_{\text{ij}},$$

in which Y_ij is the measured dependent variable, μ is the overall mean, α_i is the effect of treatments, and ε_ij is the random error.

Analyses were carried out using the GLM procedure of SAS (Statistical Analysis System, version 9.4). Comparison between treatment averages was performed using Tukey's test. A significance level of 0.05 was applied.

3. Results

3.1. Performance and carcass yield

There was no treatment effect (P>0.05) on performance and carcass yield (Tables 3 and 4).

Table 3
Growth performance of broiler chickens from 22 to 42 days of age

	Purified lignin (g/kg of diet)				SEM	P-value
	0	5	10	15
Body weight gain (kg/bird)	1.986	1.949	1.944	1.895	0.015	0.184
Feed intake (kg/bird)	3.598	3.669	3.645	3.626	0.012	0.176
Feed conversion ratio	1.81	1.89	1.88	1.92	0.01	0.094

• SEM - standard error of mean (n = 10 for treatment).

Table 4
Carcass yield, intestine and abdominal fat (% of live weight), and breast and thighs with drumstick (% of carcass) of broiler chickens at 42 days of age

	Purified lignin (g/kg of diet)				SEM	P-value
	0	5	10	15
Carcass yield (%)	78.03	78.29	77.62	77.59	0.25	0.733
Breast (%)	37.39	37.92	37.86	37.57	0.19	0.747
Thighs with drumstick (%)	26.72	26.58	26.82	27.02	0.17	0.854
Intestine (%)	3.12	3.11	3.15	3.09	0.04	0.946
Abdominal fat (%)	0.79	0.80	0.71	0.69	0.03	0.481

• SEM - standard error of mean (n = 10 for treatment).

3.2. Relative weights of organs

There was no significant treatment effect (P>0.05) on the relative weights of the bursa, spleen, liver, intestine, and abdominal fat (Table 5).

Table 5
Relative weights of bursa, spleen, and liver (% of live weight) of broiler chickens at 42 days of age

	Purified lignin (g/kg of diet)				SEM	P-value
	0	5	10	15
Bursa (%)	0.090	0.088	0.102	0.097	0.006	0.851
Spleen (%)	0.107	0.104	0.113	0.105	0.003	0.789
Liver (%)	1.528	1.586	1.529	1.600	0.021	0.515

• SEM - standard error of mean (n = 10 for treatment).

3.3. Serum metabolites

Purified lignin supplementation did not influence (P>0.05) serum levels of glucose, triglycerides, uric acid, MDA, or the T3 and T4 hormones (Table 6).

Table 6
Serum metabolites in broiler chickens at 42 days of age

	Purified lignin (g/kg of diet)				SEM	P-value
	0	5	10	15
Glucose (mg/dL)	207.6	205.3	210.7	209.3	3.7	0.965
Triglycerides (mg/dL)	46.5	48.4	37.9	37.8	2.6	0.338
Uric acid (mg/dL)	3.76	4.11	4.33	3.46	0.30	0.768
Malondialdehyde (nmol/mL)	2.89	2.93	2.98	2.80	0.10	0.944
T3 (ng/mL)	0.39	0.30	0.35	0.42	0.04	0.726
T4 (mcg/mL)	0.75	0.96	0.68	0.80	0.06	0.469

• T3 - triiodothyronine; T4 - thyroxine; SEM - standard error of mean (n = 10 for treatment).

3.4. mRNA content

The abundance of mRNA of NF-κB, HSP70, GPX, and SOD1 in the liver was not influenced by treatments (P>0.05; Figure 1).

Figure 1
mRNA expression of heat shock protein 70 (HSP70), nuclear factor-κB (NF-κB), glutathione peroxidase (GPX), and Cu,Zn-superoxide dismutase (SOD1) in liver of broilers at 42 days of age in response of addition of purified lignin to the diet.

4. Discussion

Heat stress is known to impair the performance of broilers (Hamidi et al., 2022) and cause mitochondrial damage by destabilizing the antioxidant system with an increase in reactive oxygen species (Lu et al., 2017). Furthermore, HS can reduce carcass yield (Baxter et al., 2020). In this study, it was expected that lignin supplementation in its purified form would improve the performance of broiler chickens subjected to HS. However, this hypothesis was not confirmed. No effects of lignin supplementation were observed on broiler performance, carcass yield, or the relative weights of carcass parts. A previous study reported that broilers fed diet supplemented with 12.5 g/kg of purified lignin presented increased villi height and a greater number of goblet cells in the jejunum, along with a lower population of E. coli in the litter; however, there was no positive effect on performance (Baurhoo et al., 2007b).

Performance is affected when birds are subjected to HS, because their metabolic rates are altered and their consumption is reduced. This is justified by the diversion of nutrients to meet homeostatic activities, in addition to the impairment of lipid and carbohydrate absorption (Montgomery and Turner, 2015) and changes in serum glucose levels due to changes in the gene expression of nutrient transporters, such as the family of glucose transporters (Sun et al., 2015). However, in the present study, according to the performance results, lignin supplementation did not influence the serum levels of glucose, uric acid, or triglycerides.

Atrophy of lymphoid tissues and liver may be associated with a series of HS-induced disorders (e.g., malnutrition, inflammation, and oxidative stress; Quinteiro-Filho et al., 2010; Hirakawa et al., 2020). In the present study, we evaluated the relative weights of the lymphoid organs (bursa and spleen) and liver, and found that lignin supplementation did not influence these variables either.

Metabolic alterations caused by HS are evidenced by changes in the concentrations of hormones responsible for basal metabolism, such as thyroid hormones. Heat stress normally induces reductions in T3 and T4 plasma concentrations. This response is considered an adaptive mechanism to avoid extra heat load by reducing metabolic heat production, thereby reducing maintenance energy requirements (Gonzalez-Rivas et al., 2020). However, no effects were observed on serum levels of the T3 and T4 hormones with lignin supplementation.

Several researchers have reported that thermal stress increases the expression of the HSP70 gene, which plays an essential protective role against tissue injuries (Yu et al., 2008; Varasteh et al., 2015). In the present study, to assess the ability of lignin to reduce the impact of HS, we measured the mRNA expression of HSP70 in the livers of broilers and observed no effect.

Heat stress increases the production of reactive oxygen species and may decrease natural antioxidant capabilities; both of these factors can induce oxidative stress (Gonzalez-Rivas et al., 2020). NF-κB plays an active role in the inflammatory response of chickens (Lan et al., 2017), and studies have shown an association between increased NF-κB expression levels and HS (Sahin and Smith, 2016). Previous studies with broilers indicate that exposure to HS downregulates the mRNA expression of NF-κB in the bursa of Fabricius (Liu et al., 2021), while it upregulates the mRNA expression of SOD (Roushdy et al., 2018). Another consequence of HS is an increase in lipid peroxidation, which generates greater production of MDA (Pamok et al., 2009). In a study with the Isa Brown laying strain, lignin supplementation in a diet contaminated with zearalenone prevented an increase in glutathione peroxidase activity in the duodenal mucosa (Grešáková et al., 2012). Thus, it was hypothesized that dietary supplementation of purified lignin could improve the antioxidant response of broiler chickens subjected to HS. To assess the ability of lignin to influence antioxidant response, we evaluated the mRNA abundance of NF-κB, GPX, and SOD1 in the liver. However, in accordance with other results observed in this study, these variables were not influenced.

5. Conclusions

Supplementation of 5, 10, or 15 g of purified lignin/kg of diet does not improve performance or the antioxidant response of broiler chickens subjected to heat stress.

Acknowledgments

We thank the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES).

References

• Baurhoo, B.; Letellier, A.; Zhao, X. and Ruiz-Feria, C. A. 2007a. Cecal populations of Lactobacilli and Bifidobacteria and Escherichia coli populations after in vivo Escherichia coli challenge in birds fed diets with purified lignin or mannanoligosaccharides. Poultry Science 86:2509-2516. https://doi.org/10.3382/ps.2007-00136
  » https://doi.org/10.3382/ps.2007-00136
• Baurhoo, B.; Phillip, L. and Ruiz-Feria, C. A. 2007b. Effects of purified lignin and mannan oligosaccharides on intestinal integrity and microbial populations in the ceca and litter of broiler chickens. Poultry Science 86:1070-1078. https://doi.org/10.1093/ps/86.6.1070
  » https://doi.org/10.1093/ps/86.6.1070
• Baxter, M. F. A.; Greene, E. S.; Kidd, M. T.; Tellez-Isaias, G.; Orlowski, S. and Dridi, S. 2020. Water amino acid-chelated trace mineral supplementation decreases circulating and intestinal HSP70 and proinflammatory cytokine gene expression in heat-stressed broiler chickens. Journal of Animal Science 98:skaa049. https://doi.org/10.1093/jas/skaa049
  » https://doi.org/10.1093/jas/skaa049
• Bosetti, G. E.; Griebler, L.; Aniecevski, E.; Facchi C. S.; Baggio, C.; Rossato, G.; Leite, F.; Valentini, F. D. A.; Santo, A. D.; Pagnussat, H.; Boiago, M. M. and Petrolli, T. G. 2020. Microencapsulated carvacrol and cinnamaldehyde replace growth-promoting antibiotics: Effect on performance and meat quality in broiler chickens. Anais da Academia Brasileira de Ciências 92:e20200343. https://doi.org/10.1590/0001-3765202020200343
  » https://doi.org/10.1590/0001-3765202020200343
• Bozin, B.; Mimica-Dukic, N.; Simin, N. and Anackov, G. 2006. Characterization of the volatile composition of essential oils of some lamiaceae spices and the antimicrobial and antioxidant activities of the entire oils. Journal of Agricultural and Food Chemistry 54:1822-1828. https://doi.org/10.1021/jf051922u
  » https://doi.org/10.1021/jf051922u
• Galli, G. M.; Gerbet, R. R.; Griss, L. G.; Fortuoso, B. F.; Petrolli, T. G.; Boiago, M. M.; Souza, C. F.; Baldissera, M. D.; Mesadri, J.; Wagner, R.; Rosa, G.; Mendes, R. E.; Gris, A and Silva, A. S. 2020. Combination of herbal components (curcumin, carvacrol, thymol, cinnamaldehyde) in broiler chicken feed: impacts on response parameters, performance, fatty acid profiles, meat quality and control of coccidia and bacteria. Microbial Pathogenesis 139:103916. https://doi.org/10.1016/j.micpath.2019.103916
  » https://doi.org/10.1016/j.micpath.2019.103916
• Gonzalez-Rivas, P. A.; Chauhan, S. S.; Ha, M.; Fegan, N.; Dunshea, F. R. and Warner, R. D. 2020. Effects of heat stress on animal physiology, metabolism, and meat quality: a review. Meat Science 162:108025. https://doi.org/10.1016/j.meatsci.2019.108025
  » https://doi.org/10.1016/j.meatsci.2019.108025
• Grešáková, Ľ.; Bořutová, R.; Faix, Š.; Plachá, I.; Čobanová, K.; Košíková, B. and Leng, Ľ. 2012. Effect of lignin on oxidative stress in chickens fed a diet contaminated with zearalenone. Acta Veterinaria Hungarica 60:103-114. https://doi.org/10.1556/avet.2012.009
  » https://doi.org/10.1556/avet.2012.009
• Habashy, W. S.; Milfort, M. C.; Rekaya, R. and Aggrey, S. E. 2018. Expression of genes that encode cellular oxidant/antioxidant systems are affected by heat stress. Molecular Biology Reports 45:389-394. https://doi.org/10.1007/s11033-018-4173-0
  » https://doi.org/10.1007/s11033-018-4173-0
• Hamidi, O.; Chamani, M.; Ghahri, H.; Sadeghi, A. A.; Malekinejad, H. and Palangi, V. 2022. Effects of supplemental chromium nanoparticles on IFN-γ expression of heat stress broilers. Biological Trace Element Research 200:339-347. https://doi.org/10.1007/s12011-021-02634-0
  » https://doi.org/10.1007/s12011-021-02634-0
• Hirakawa, R.; Nurjanah, S.; Furukawa, K.; Murai, A.; Kikusato, M.; Nochi, T. and Toyomizu, M. 2020. Heat stress causes immune abnormalities via massive damage to effect proliferation and differentiation of lymphocytes in broiler chickens. Frontiers in Veterinary Science 7:46. https://doi.org/10.3389/fvets.2020.00046
  » https://doi.org/10.3389/fvets.2020.00046
• Lan, X.; Hsieh, J. C.; Schmidt, C. J.; Zhu, Q. and Lamont, S. J. 2017. Heat stress alters immune pathways in liver of divergent chicken lines. Iowa State University Animal Industry Report 14(1). https://doi.org/10.31274/ans_air-180814-335
  » https://doi.org/10.31274/ans_air-180814-335
• Lara, L. J. and Rostagno, M. H. 2013. Impact of heat stress on poultry production. Animals 3:356-369. https://doi.org/10.3390/ani3020356
  » https://doi.org/10.3390/ani3020356
• Liu, W.-C.; Ou, B.-H.; Liang, Z.-L.; Zhang, R. and Zhao, Z.-H. 2021. Algae-derived polysaccharides supplementation ameliorates heat stress-induced impairment of bursa of Fabricius via modulating NF-κB signaling pathway in broilers. Poultry Science 100:101139. https://doi.org/10.1016/j.psj.2021.101139
  » https://doi.org/10.1016/j.psj.2021.101139
• Livak, K. J. and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2^−ΔΔC_T method. Methods 25:402-408. https://doi.org/10.1006/meth.2001.1262
  » https://doi.org/10.1006/meth.2001.1262
• Lu, Z.; He, X.; Ma, B.; Zhang, L.; Li, J.; Jiang, Y.; Zhou, G. and Gao, F. 2017. Chronic heat stress impairs the quality of breast-muscle meat in broilers by affecting redox status and energy-substance metabolism. Journal of Agricultural and Food Chemistry 65:11251-11258. https://doi.org/10.1021/acs.jafc.7b04428
  » https://doi.org/10.1021/acs.jafc.7b04428
• Montgomery, M. K. and Turner, N. 2015. Mitochondrial dysfunction and insulin resistance: an update. Endocrine Connections 4:R1-R15. https://doi.org/10.1530/EC-14-0092
  » https://doi.org/10.1530/EC-14-0092
• Pamok, S.; Aengwanich, W. and Komutrin, T. 2009. Adaptation to oxidative stress and impact of chronic oxidative stress on immunity in heat-stressed broilers. Journal of Thermal Biology 34:353-357. https://doi.org/10.1016/j.jtherbio.2009.06.003
  » https://doi.org/10.1016/j.jtherbio.2009.06.003
• Quinteiro-Filho, W. M.; Ribeiro, A.; Ferraz-de-Paula, V.; Pinheiro, M. L.; Sakai, M.; Sá, L. R. M.; Ferreira, A. J. P. and Palermo-Neto, J. 2010. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poultry Science 89:1905-1914. https://doi.org/10.3382/ps.2010-00812
  » https://doi.org/10.3382/ps.2010-00812
• Rostagno, H. S.; Albino, L. F. T.; Hannas, M. I.; Donzele, J. L.; Sakomura, N. K.; Perazzo, F. G.; Saraiva, A.; Teixeira, M. L.; Rodrigues, P. B.; Oliveira, R. F.; Barreto, S. L. T. and Brito, C. O. 2017. Tabelas brasileiras para suínos e aves: composição de alimentos e exigências nutricionais. 4.ed. Departamento de Zootecnia, UFV, Viçosa, MG. 488p.
• Roushdy, E. M.; Zaglool, A. W. and El-Tarabany, M. S. 2018. Effects of chronic thermal stress on growth performance, carcass traits, antioxidant indices and the expression of HSP70, growth hormone and superoxide dismutase genes in two broiler strains. Journal of Thermal Biology 74:337-343. https://doi.org/10.1016/j.jtherbio.2018.04.009
  » https://doi.org/10.1016/j.jtherbio.2018.04.009
• Sahin, K. and Smith, M. O. 2016. Regulation of transcription factors by the epigallocatechin-3-gallate in poultry reared under heat stress. World's Poultry Science Journal 72:299-306. https://doi.org/10.1017/S0043933916000209
  » https://doi.org/10.1017/S0043933916000209
• Sun, X.; Zhang, H.; Sheikhahmadi, A.; Wang, Y.; Jiao, H.; Lin, H. and Song, Z. 2015. Effects of heat stress on the gene expression of nutrient transporters in the jejunum of broiler chickens (Gallus gallus domesticus). International Journal of Biometeorology 59:127-135. https://doi.org/10.1007/s00484-014-0829-1
  » https://doi.org/10.1007/s00484-014-0829-1
• Surai, P. F.; Kochish, I. I.; Fisinin, V. I. and Kidd, M. T. 2019. Antioxidant defence systems and oxidative stress in poultry biology: an update. Antioxidants 8:235. https://doi.org/10.3390/antiox8070235
  » https://doi.org/10.3390/antiox8070235
• Vance, C. P.; Kirk, T. K. and Sherwood, R. T. 1980. Lignification as a mechanism of disease resistance. Annual Review of Phytopathology 18:259-288. https://doi.org/10.1146/annurev.py.18.090180.001355
  » https://doi.org/10.1146/annurev.py.18.090180.001355
• Varasteh, S.; Braber, S.; Akbari, P.; Garssen, J. and Fink-Gremmels, J. 2015. Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galacto-oligosaccharides. PLOS ONE 10:e0138975. https://doi.org/10.1371/journal.pone.0138975
  » https://doi.org/10.1371/journal.pone.0138975
• Yu, J.; Bao, E.; Yan, J. and Lei, L. 2008. Expression and localization of Hsps in the heart and blood vessel of heat-stressed broilers. Cell Stress Chaperones 13:327-335. https://doi.org/10.1007/s12192-008-0031-7
  » https://doi.org/10.1007/s12192-008-0031-7
• Zhang, J.; Bai, K. W.; He, J.; Niu, Y.; Lu, Y.; Zhang, L. and Wang, T. 2018. Curcumin attenuates hepatic mitochondrial dysfunction through the maintenance of thiol pool, inhibition of mtDNA damage, and stimulation of the mitochondrial thioredoxin system in heat-stressed broilers. Journal of Animal Science 96:867-879. https://doi.org/10.1093/jas/sky009
  » https://doi.org/10.1093/jas/sky009

Publication Dates

• Publication in this collection
  18 Apr 2022
• Date of issue
  2022

History

• Received
  13 Aug 2021
• Accepted
  14 Feb 2022