Screening of cyanotoxin producing genes in Ecuadorian freshwater systems

Triagem de genes produtores de cianotoxinas em sistemas de água doce do Equador

Abstract:

Aim

This study pursued the detection of cyr and mcy genes to assess the presence of cylindrospemopsin (CN) and microcystin (MC) potential producers in Ecuadorian water bodies.

Methods

Environmental DNA (eDNA) was extracted from eight water bodies and one wastewater treatment plant (WWTP) from Ecuador. A nested PCR was designed to amplify mcyB, cyrE, and cyrJ genes in these environmental samples. PCR products were sequenced and blasted against GenBank database.

Results

Potential CN producers were found in seven water bodies and the WWTP. cyrE amplification revealed three variants belonging to Raphidopsis and Aphanizmenon species and one for cyrJ with around 90% identity with Raphidiopsis and Oscillatoria species. Four water bodies presented the same variant for mcyB similar to Microcystis panniformis with 99% of identity.

Conclusions

This study contributes new data on the presence of toxic cyanobacteria strains and provides new molecular tools to assess cyanotoxin hazards in Ecuadorian water bodies.

Keywords:
cylindrospermopsin; microcystin; nested PCR; Andes; Amazon

Resumo:

Objetivo

Este estudo buscou a detecção de genes cyr e mcy para avaliar a presença de potenciais produtores de cilindrospemopsina (CN) e microcistina (MC) em corpos d'água equatorianos.

Métodos

O DNA ambiental (eDNA) foi extraído de oito corpos d'água e uma estação de tratamento de águas residuais (ETAR) do Equador. Uma “nested” PCR foi projetada para amplificar os genes mcyB, cyrE e cyrJ nessas amostras ambientais. Os produtos de PCR foram sequenciados e pesquisados no banco de dados GenBank.

Resultados

Potenciais produtores de CN foram encontrados em sete corpos d'água e na ETAR. A amplificação de cyrE revelou três variantes pertencentes à espécies dos gêneros Raphidopsis e Aphanizomenon e uma para cyrJ com cerca de 90% de identidade com espécies dos gêneros Raphidiopsis e Oscillatoria. Quatro corpos d'água apresentaram a mesma variante para mcyB semelhante a Microcystis panniformis com 99% de identidade.

Conclusões

Este estudo contribui com novos dados sobre a presença de cianobactérias tóxicas e fornece novas ferramentas moleculares para avaliar os riscos de cianotoxinas em corpos d'água equatorianos.

Palavras-chave:
cilindrospermopsina; microcistina; nested PCR; Andes; Amazônia

Graphical Abstract

1. Introduction

The proliferation of harmful algae or harmful algal blooms (HABs) can severely impact water quality and present risks to public health (Gobler, 2020). Concerns about inland HABs are commonly related to cyanobacteria, which potentially produce undesirable secondary metabolites, including cyanotoxins (CNs). Exposure to cyanotoxins can lead to adverse health outcomes and directly affect biodiversity and ecosystem services (Percival & Williams, 2013). Other negative effects include degradation of water quality for drinking and recreational use (Abeysiriwardena et al., 2018; Carmichael & Boyer, 2016; Metcalf et al., 2018).

CNs include anatoxins, cylindrospermopsins, L-beta-N-methylamino-L-alanine, microcystins, nodularins, and saxitoxins (Meriluoto et al., 2017). Among them, microcystins (MCs) and CNs have emerged in the past few decades as freshwater cyanobacterial toxins of increasing concern (Adamski et al., 2020; Corbel et al., 2014; Massey & Yang, 2020). In 1996, the death of 52 dialysis patients due to liver failure was traced back to water contaminated with cyanobacteria and the presence of MCs in a Brazilian hospital (Carmichael, 2001). These tragic incidents in Brazil triggered interest in assessing the toxicity of MCs and monitoring environmental concentrations. MCs may be typically classified as hepatotoxin, however, their effects extend beyond the liver. For instance, chronic exposure to MC also has harmful effects on the renal system including necrosis, hemorrhages, and infiltration of leukocytes (Milutinović et al., 2002). In the gastrointestinal system, colorectal/rectal carcinomas in humans may be worsened by microcystin exposure (Zhou et al., 2002). CN was also responsible for a significant human-poisoning incident reported on Palm Island, Australia, in 1979 (Antunes et al., 2015). CN was characterized as hepatotoxic in the early 1990s (Ohtani et al., 1992), but later has also been identified as potentially genotoxic, dermatotoxic, developmentally toxic, and carcinogenic (de la Cruz et al., 2013), mostly based on findings in mammals. Several studies using human hepatic cells or rodent models have identified pathological and metabolic changes in the liver by CN exposure (Huguet et al., 2019; Seawright et al., 1999). In addition, CN has been shown to cause oxidative stress, increase DNA strand breaks, and decrease natural cell apoptosis in mammalian hepatocytes and blood lymphocytes (Hercog et al., 2017; Štraser et al., 2013)

Cylindrospermopsis raciborskii, renamed Raphidiopsis raciborskii in 2018 (Aguilera et al., 2018), was identified as a producer of CN by Hawkins, et al.(1985). Since then, it has been shown that this molecule is also produced by cyanobacteria belonging to other genera such as Anabaena, Aphanizomenon, Dolichospermum, Lyngbya, Raphidiopsis, and Umezakia (Kokociński et al., 2017; Stüken et al., 2006). MC and/or CN has been reported to be present in water bodies in Germany (Mantzouki et al., 2018; Wiedner et al., 2008), the United States (Howard et al., 2017; Loftin et al., 2016), Brazil (Bittencourt-Oliveira et al., 2011; Lorenzi et al., 2018; Walter et al., 2018), Spain (Cirés et al., 2014), and Ecuador (Van Colen et al., 2017), among others.

However, cyanobacterial toxins, including MC and CN, are not routinely monitored in all parts of the world due to the unavailability of expensive analytical equipment, training capacity, and difficulty in culturing and preparing samples for analysis (Abeysiriwardena et al., 2018). Even though several standardized protocols in cyanotoxin analysis have been developed specifically for liquid chromatography-mass spectrometry (LC-MS/MS) (Haddad et al., 2019; Meriluoto et al., 2017), this method is expensive, leading to cyanotoxin monitoring efforts being concentrated in rich and developing countries (Haddad et al., 2019). An easier and more economical way to assess the presence of cyanotoxins, especially for countries with limited facilities such as Ecuador, is the detection of toxin synthesis-related genes by PCR using environmental DNA (eDNA) extracted from water samples as a template. In fact, eDNA is one of the best options for biomonitoring and screening the presence of potentially toxic species (Seymour, 2019). The description of microcystin synthesis genes (mcyA-J) (Christiansen et al., 2003; Nishizawa et al., 2000) and the gene cluster responsible for cylindrospermopsin biosynthesis (cyrA-O) (Mihali et al., 2008) enable the design of toxic strain-specific primers to test the presence of MC- and CN-producing cyanobacteria by using PCR techniques (Lei et al., 2019; Zhang et al., 2014).

Since mcyA, mcyB, and mcyC genes are essential for MC production, any of them are commonly used for detecting potential producers (Kurmayer et al., 2004; Massey & Yang, 2020; Mikalsen et al., 2003; Thomas & Dittmann, 2005; Via-Ordorika et al., 2004). However, the case of CN production by the cyr cluster is more controversial than MC. It has been reported in the genus Aphanizomenon that CN-producing and non-CN-producing strains possess cyrA, cyrB, and cyrC genes encoding polyketide synthases (PKS) and peptide synthetases (PS) putatively involved in CN synthesis (PKS) (Rasmussen et al., 2008; Schembri et al., 2001; Shalev-Alon et al., 2002). Thus, the detection of these genes may not guarantee that these strains produce CN. A study by Mihali et al. (2008) revealed that cyrJ, a sulfotransferase-encoding gene, was present only in CN-producing strains, supporting the involvement of this gene in the biosynthesis of CN.

The aim of our work was to perform a molecular screening of MC and CN producers in some Ecuadorian water bodies considering all the information above. The sequence of the amplified genes revealed the presence of cyr genes related to Raphidiopsis and Aphanizomenon and the presence of mcy genes related to Microcystis. Therefore, this study confirms the existence of potential CN and MC producers in Ecuador, reveals a new variant of the cyrJ gene, and provides new tools to assess cyanotoxin hazards in Ecuadorian water bodies.

2. Materials and Methods

2.1. Study area

Eight water bodies and one wastewater treatment plant (WWTP) were chosen for this research (Figure 1; Table 1), with details as follows: i) Yahuarcocha Lagoon is located in Imbabura province. It is a eutrophic lagoon, since it is a recipient of wastewater discharges, fertilizers, and cattle grazing (Echeverría-Almeida & Athens, 2016). ii) San Pablo is a β-mesotrophic (moderate pollution) lake also located in Imbabura. Its poor conditions are due to the presence of chemical residues used in plant fertilization and livestock care (Rodríguez-Ayala et al., 2018). iii) Limoncocha Lagoon is in the Limoncocha Biological Reserve in the southwestern part of Sucumbios province. This eutrophic water body receives domestic wastewater and agricultural leachate (Carrillo et al., 2021). iv) San Pedro River is part of the upper basin of Guayllabamba in Pichincha province and is increasingly influenced by anthropogenic activities with direct sewage discharges. The sample point is located downstream in the Sangolquí district and is α-mesotrophic (strong pollution) (Ríos-Touma et al., 2022). v) Yambo is a lagoon located in Cotopaxi province and is considered eutrophic since it is a direct recipient of waste from nearby private complexes and the devastation of nearby vegetation (Orquera & Cabrera, 2020). vi) Uruzhapa is a β-mesotrophic artificial-lake situated in Uruzhapa, San Pedro de la Bendita, in Loja province. Its water is used exclusively for irrigating local crops. vii) Guápulo: β-mesotrophic artificial pond located in Guápulo Park in Quito. viii) Mojanda Lagoon is β-mesotrophic due to the constant extension of agricultural activities into the paramo ecosystem above 3,000 m asl, threatening the quality of water and causing lower amounts of precipitation, which in turn creates more concentrated levels of contaminations in the outflow (Schutz, 2014). ix) The WWTP is situated in “Universidad de las Américas” and its purpose is to treat the sewage generated from the facilities. Water treatment is mainly based on the use of trickling filters and sedimentation tanks.

Figure 1
Map of Ecuador showing the sampling sites. Name codes of sampling sites are listed in Table 1.

Table 1
List of the sampling sites along with the name code, type of water body, longitude, latitude, and altitude. In meters above sea level (m asl), trophic status and temperature (Te).

Code	Water body	Longitude	Latitude	Altitude (m asl)	Trophic Status	Te (ºC)
GUA	Guápulo Artificial Pond	-78.472955	-0.197881	2597	β-mesotrophic	13
LIM	Limoncocha Lagoon	-76.619404	-0.406792	244	eutrophic	28
MOJ	Mojanda Lagoon	-78.273007	0.140353	3742	β-mesotrophic	11
SAN	San Pablo Lake	-78.237102	0.215909	2664	β-mesotrophic	21
SAP	San Pedro River	-78.460100	0.296226	2446	α-mesotrophic	18
UDL	UDLA WWTP	-7.458998	-0.162997	2837	-	-
URU	Uruzhapa Artificial Lake	-7.438013	-3.948732	1816	β-mesotrophic	18
YAH	Yahuarcocha Lake	-78.108984	0.376199	2191	β-mesotrophic	21
YAM	Yambo Lake	-78.58589	-1.104991	2579	eutrophic	21

2.2. Environmental sampling

A total of 8 planktonic samples (one from each water body except WWTP) and 8 biofilm samples (one from WWTP and each water body except Limoncocha) were collected from May to June 2019. Planktonic samples comprised 2L subsurface water (0.5m deep) from each location whereas biofilm samples were scrubbed off the upper surface of three to five submerged stones, 10 to 20 cm in diameter, using a toothbrush (Kobayasi & Mayama, 1982). Samples were kept cold until their transfer to the laboratory. Access to freshwater ecosystems was conferred by the Environment Ministry of Ecuador (MAE) via the permission codes MAE-DNB.CM-2018-0093.

2.3. DNA extraction

Extraction was performed using commercially available kits following the manufacturer’s instructions. For planktonic samples, 2L of collected water was filtered in a 0.45µm Whatman® mixed cellulose ester membrane. The filter was scrubbed and the DNA from the resultant material was extracted with PureLink™ Microbiome DNA Purification Kit. Using the same kit, biofilm samples were extracted without the previous processing for water samples. DNA concentration and purity of the samples were evaluated using a NanoDrop spectrophotometer (ThermoFisher Scientific). DNA was stored at –20 °C for further analyses.

2.4. Nested-PCR analyses

To check the success of the DNA extraction and the absence of inhibition in the PCR reaction, the amplification of the region 16S rDNA gene was carried out as a positive control using the primers CYA106F / CYA781R (Nübel et al., 1997) and PCR conditions, as outlined by Ballesteros et al. (2021). eDNA samples with a positive amplification for the 16S were considered suitable for further analysis.

A nested PCR assay was developed to enhance the specificity and signal amplification of the mcyB, cyrE, and cyrJ genes in environmental samples (Fan et al., 2009). Two sets of primers (outer and inner) were designed for the mcyB and cyrE genes with the Primer-BLAST tool, developed at the NCBI web page (Ye et al. 2012). The sequences from seven species belonging to the Microcystis genus were downloaded (January 2019) to design mcyB primers (M. aeruginosa CP020771, M. viridis AP019314.11, M. panniformis CP011339.1, M. ichthyoblabe KJ818158.1, M. botrys KJ818139.1, M. smithii KJ818124.1, M. novacekii KJ818122.1) and four sequences for cyrE and cyrJ primers (Raphidiopsis curvata KJ139745.1, Cylindrospermopsis raciborskii KJ139743.1, Aphanizomenon sp GQ385961.1, Oscillatoria sp FJ418586.4). Because of the small size of the amplification product, one set of primers was designed for the cyrJ gene including one reverse and two forward primers and the reverse primer was combined with a forward primer from a previous study (Mankiewicz-Boczek et al., 2012) to perform the second PCR. The primers used are listed in Table 2, along with the sequence and position from the first nucleotide of the start codon.

Table 2
Primers designed to amplify mcyB, cyrE, and cyrJ by nested PCR. Primers named as N1 were used for the first PCR and N2 for the second round, except for CyrJN1Rv, which was used for PCR1 and 2. The symbol * indicates that the primer was retrieved from Mankiewicz-Boczek, et al. (2012). Primer positions are referred to as the ATG from Microcystis viridis (mcy) and Raphidiopsis raciborskii (cyr).

Target gene	Primer name	Sequence (5’→ 3’)	Position
mcyB	McyN1Fw	AGAATCCGCAGGGAATAGCG	282
	McyN1Rv	CTTGGGCATTAGCAAGGGGA	1208
	McyN2Fw	AAAAGCCGGGGGAGCTTATG	460
	McyN2Rv	ACCGCTACTTCTGTTGGTCC	1137
cyrE	CyrEN1Fw	ATGGGGCGATGGTTTCAGTT	597
	CyrEN1Rv	CCATTTGCATACGACTCGGC	1479
	CyrEN2Fw	GCGATTCAATCTGTCAGCCG	644
	CyrEN2Rv	GCTTCATGCACCTGTCCAGT	1328
cyrJ	CyrJN1Fw	CCACGCAGTTTTGGTACAGTG	33
	CyrJN1Rv	CCCCTACAGCCTGACAAAGC	560
	CyrJN2Fw*	TTCTCTCCTTTCCCTATCTCTTTATC	103

First, PCR was performed in reactions of 20 µL, with Phusion High-Fidelity polymerase (Thermo FisherTM) containing 1x Master Mix with HF buffer, 0.25 µM of each outer primer (N1Fw/N1Rv), and 25 – 100 ng of extracted eDNA. The first PCR was performed for 35 cycles as follows: initial denaturation step at 98 °C for 2 min, subsequent denaturation step at 98 °C for 30 s, annealing step at 53 °C (mcyB and cyrE) and 58 °C (cyrJ) for 20 s, extension step at 72 °C for 30 s, and final extension for 2 min at 72 °C. One microliter of the amplified product was used as a DNA template for the second PCR. The second PCR was run as follows: 98 °C for 30 s, then 25 cycles of 98 °C for 15 s, 58 °C (mcyB and cyrE) and 55ºC (cyrJ) for 15 s and 72 °C for 20 s, and finally 72 °C for 1 min. Every PCR assay included a negative control containing all reagents without the DNA sample. PCR products of the second PCR were analyzed on a 1.5% w/v agarose gel stained with ethidium bromide (0.5 ng L^-1) and visualized using the GelDoc XR system (Bio-Rad).

2.5. Sequencing and sequence analysis

Amplicons of the expected size were purified using AccuPrep PCR/Gel Purification Kit (Bioneer) and sequenced at the sequencing service of Universidad de Las Américas (Quito, Ecuador). Sequences were edited with MEGA X software (Kumar et al., 2018) and submitted to a search in the GeneBank database at the NCBI website using the Basic Local Alignment Tool (BLASTn) (McGinnis and Madden, 2004).

The sequences obtained were registered in the NCBI nucleotide database under the following accession numbers: mcyB “MZ615179”; cyrE1 “MZ615175”; cyrE2 “MZ615176”; cyrE3 “MZ615177”; cyrJ “MZ615178”.

3. Result and Discussion

We assessed eight water bodies from urban and rural areas in Ecuador and one WWTP situated in “Universidad de las Americas” facilities to detect mcyB and cyrJ/E genes. Although most studies report planktonic cyanobacterium hazards, previous works demonstrated that in both planktonic and biofilm samples, there might be the potential for cyanotoxin production (Belykh et al., 2016; Lajeunesse et al., 2012; Mohamed et al., 2006; Smith et al., 2011; Zupančič et al., 2021). Thus, we took samples from plankton and biofilms from every water body except Limoncocha due to the lack of solid submerged substrates. The WWTP sample was taken from the trickling filter biofilm. Four primers were used to perform a nested PCR to amplify mcyB and cyrE, and just three for cyrJ due to the small size of this gene. This method is well-known for its high sensitivity and specificity when facing low concentrations of target DNA, as is the case when using eDNA as a template (Fan et al., 2009). In some samples, the second PCR generated multiple bands, as previously reported in similar works (Mankiewicz-Boczek et al., 2012; Stefanova et al., 2020). In these cases, we consider as positive results the appearance of a band of the expected size which was extracted from the agarose gel and sequenced.

Mcy primers were designed to amplify the mcyB gene from the Microcystis genus, since these species are abundant, have numerous bloom occurrences, and commonly produce MC (Massey & Yang, 2020). The nested PCR was positive for samples from Guápulo (biofilm), Limoncocha (plankton), San Pablo (plankton and biofilm), and Yahuarcocha (plankton and biofilm) with the amplification of a fragment of the mcyB gene of the expected size (687 bp) (Table 3). Despite the existence of multiple alleles described for Microcystis sp. (Massey & Yang, 2020), we detected the same gene variant for the four water bodies. The BLASTn showed only one mismatched nucleotide with mcyB gene from Microcystis panniformis that has been previously reported as an MC producer in the neotropical region (Bittencourt-Oliveira et al., 2011).

Table 3
List of the sampling points showing the variants of the amplification and sequencing of the assessed genes in this study: mcyB1 from Microcystis panniformis; cyr E1 from Raphidiopsis raciborskii; cyrE2 from Aphanizomenon sp; cyrE3 from Raphidiopsis curvata n.d.: not detected. (b)= biofilm samples. Name codes of sampling sites are listed in Table 1 . (p)=plankton samples.

Sample code	mcyB sequence	cyrE sequence	cyrJ sequence
GUP	mcyB1(b)	n.d.	n.d.
LIM	mcyB1(p)	cyrE1(p)	n.d.
MOJ	n.d.	cyrE1(b)	cyrJ1(b)
SAN	mcyB1(p,b)	cyrE2(b)	n.d.
SAP	n.d.	cyrE3 (p)	n.d.
UDL	n.d.	cyrE1(p)	n.d.
URU	n.d.	cyrE2(p)	n.d.
YAH	mcyB1(p,b)	cyrE1(b)	n.d.
YAM	n.d.	cyrE1(p)	n.d.

The primers for cyrJ were designed to amplify genes from the main genera described as putative CN producers, such as Oscillatoria, Cylindrospermopsis, Raphidiopsis curvata, and Aphanizomenon (Adamski et al., 2020). The only positive sample for this gene was eDNA isolated from Mojanda biofilm (Table 3). The closest matches, with an identity of around 90%, were Raphidiopsis raciborskii, R. curvata, and Oscillatoria sp., with the latter taxa being already described as a benthic cyanobacterium genus (Gaget et al., 2017).

CyrE was amplified in Limoncocha (plankton), Uruzhapa (plankton), Yambo (plankton), Yahuarcocha (biofilm), San Pablo (biofilm), and Mojanda (biofilm) (Table 3). The sequence obtained from Limoncocha, Yambo, WWTP, Yahuarcocha and Mojanda locations was named cyrE1, while the one from Uruzhapa and San Pedro River was given the name cyrE2, and the sequence retrieved from San Pablo Lake became cyrE3. cyrE1 was most similar (99.4% identity) to cyrE3. The variation in nucleotide sequence leads to a single amino acid change from phenylalanine (cyrE1) to leucine (cyrE3). CyrE2 nucleotide sequence had 98.2% identity to cyrE3 (four amino acid changes) and 97.2% to cyrE1 (five different amino acids) (Figure 2). The cyrE1 and cyrE3 sequences revealed a 100% identity with the same gene from species belonging to the Raphidiopsis genus, specifically Raphidiopsis raciborskii and Raphidiopsis curvata, respectively. Nevertheless, cyrE2 differed from cyrE1 and cyrE3. The closest match to the cyrE2 sequence at the GenBank was 98% identity to cyrE related to Aphanizomenon sp., which has been described as a benthic cyanobacterium genus (Gaget et al., 2017). In South America, most isolated strains from R. raciborskii are reported to produce saxitoxins (Hoff-Risseti et al., 2013), although CN producers have also been found in Brazil and Venezuela (Antunes et al., 2015; Mowe et al., 2015), and Ecuador (Ballesteros et al., 2021; Van Colen et al., 2017; Venegas et al., 2018). Even though R. racibosrkii has been reported in Yahuarcocha and San Pablo in association with the presence of CN (Van Colen et al., 2017), cyrJ was not amplified from samples in these water bodies. The sequence of this gene amplified from Mojanda showed high variation with those available at the GenBank, which suggests that the varieties of cyrJ present in these water bodies might not be amplified by the primers used in this work.

Figure 2
Alignment of cyrE sequences translated into amino acids.

Except for Mojanda Lagoon, all water bodies assessed in this study might present cyanobacterial blooms due to their trophic status and temperature. The average water temperature of Yahuarcocha and San Pablo Lakes is 21 °C and is comparable to that of lowland subtropical lakes, despite their locations at 2,190 and 2,700 m asl, respectively (Kurmayer et al., 2004). Furthermore, the lack of a cold season allows cyanobacterial blooms to persist for more than one year and allows tropical fish species to survive in the lakes (Van Colen et al., 2017). The same principles could apply to the eutrophicated lagoon of Yambo, also positive for cyrE from R. raciborskii. This water body is located at 2,500 m asl with an average water temperature of 18.5 ºC. Limoncocha Lagoon also fulfills the environmental conditions for this species to bloom (Mowe et al., 2015; Padisák, 1997; Padisák & Reynolds, 1998; Whitton & Potts, 2002), as it is highly eutrophicated due to natural processes and sewage from nearby Limoncocha village and has a temperature ranging from 28 °C to 32.23 °C (Gómez Durañona, 2005). The presence of cyrE from R. raciborskii sample in this lagoon was consistent with the report of this cyanobacterium by Venegas et al. (2018). Mojanda Lagoon, where also cyrE1 sequence was detected, is located at 3,710 m asl with an average temperature of approximately 13.5 ºC, this lagoon is mesotrophic due to anthropic activities such as livestock. Thus, it is the least likely to develop a HAB (Schutz, 2014). Therefore, the lack of positives in planktonic samples in Mojanda Lagoon might be due to a lower cyanobacterial density in planktonic samples than benthic ones.

The characterization of the cyanotoxin genes present in Ecuadorian water bodies is the first step towards developing tools to detect the production of cyanotoxins through qPCR techniques, as described by Lei et al. (2019). Furthermore, this country is an outstanding set to study the effects of global warming as there is an almost constant temperature gradient along the slope from the Andes range down to the amazon region throughout the year (Cuesta et al., 2019). Therefore, the current study might be a humble first step towards future screenings that might anticipate the consequences of global warming in cyanotoxin production in the Andean region of Ecuador.

• Cite as: Ballesteros, I. et al. Screening of cyanotoxin producing genes in Ecuadorian freshwater systems. Acta Limnologica Brasiliensia, 2022, vol. 34, e24.

References

• Abeysiriwardena, N.M., Gascoigne, S.J.L., & Anandappa, A., 2018. Algal bloom expansion increases cyanotoxin risk in food. YJBM 91(2), 129-142. PMid:29955218.
• Adamski, M., Wołowski, K., Kaminski, A., & Hindáková, A., 2020. Cyanotoxin cylindrospermopsin producers and the catalytic decomposition process: A review. Harmful Algae 98, 101894. PMid:33129452. http://dx.doi.org/10.1016/j.hal.2020.101894
  » http://dx.doi.org/10.1016/j.hal.2020.101894
• Aguilera, A., Gómez, E.B., Kaštovský, J., Echenique, R.O., & Salerno, G.L., 2018. The polyphasic analysis of two native Raphidiopsis isolates supports the unification of the genera Raphidiopsis and Cylindrospermopsis (Nostocales, Cyanobacteria). Phycologia 57(2), 130-146. http://dx.doi.org/10.2216/17-2.1
  » http://dx.doi.org/10.2216/17-2.1
• Antunes, J.T., Leão, P.N., & Vasconcelos, V.M., 2015. Cylindrospermopsis raciborskii: review of the distribution, phylogeography, and ecophysiology of a global invasive species. Front. Microbiol. 6, 473. PMid:26042108. http://dx.doi.org/10.3389/fmicb.2015.00473
  » http://dx.doi.org/10.3389/fmicb.2015.00473
• Ballesteros, I., Terán, P., Guamán-Burneo, C., González, N., Cruz, A., & Castillejo, P., 2021. DNA barcoding approach to characterize microalgae isolated from freshwater systems of Ecuador. Neotrop. Biodivers. 7(1), 170-183. http://dx.doi.org/10.1080/23766808.2021.1920296
  » http://dx.doi.org/10.1080/23766808.2021.1920296
• Belykh, O.I., Tikhonova, I.V., Kuzmin, A.V., Sorokovikova, E.G., Fedorova, G.A., Khanaev, I.V., Sherbakova, T.A., & Timoshkin, O.A., 2016. First detection of benthic cyanobacteria in Lake Baikal producing paralytic shellfish toxins. Toxicon 121, 36-40. PMid:27569199. http://dx.doi.org/10.1016/j.toxicon.2016.08.015
  » http://dx.doi.org/10.1016/j.toxicon.2016.08.015
• Bittencourt-Oliveira, M.C., Oliveira, M.C., & Pinto, E., 2011. Diversity of microcystin-producing genotypes in Brazilian strains of Microcystis (Cyanobacteria). Braz. J. Biol. 71(1), 209-216. PMid:21437420. http://dx.doi.org/10.1590/S1519-69842011000100030
  » http://dx.doi.org/10.1590/S1519-69842011000100030
• Carmichael, W.W., & Boyer, G.L., 2016. Health impacts from cyanobacteria harmful algae blooms: Implications for the North American Great Lakes. Harmful Algae 54, 194-212. PMid:28073476. http://dx.doi.org/10.1016/j.hal.2016.02.002
  » http://dx.doi.org/10.1016/j.hal.2016.02.002
• Carmichael, W.W., 2001. Health effects of toxin-producing cyanobacteria: “The CyanoHABs”. Hum. Ecol. Risk Assess. Int J 7(5), 1393-1407. http://dx.doi.org/10.1080/20018091095087
  » http://dx.doi.org/10.1080/20018091095087
• Carrillo, K.C., Drouet, J.C., Rodríguez-Romero, A., Tovar-Sánchez, A., Ruiz-Gutiérrez, G., & Viguri Fuente, J.R., 2021. Spatial distribution and level of contamination of potentially toxic elements in sediments and soils of a biological reserve wetland, northern Amazon region of Ecuador. J. Environ. Manage. 289, 112495. PMid:33831761. http://dx.doi.org/10.1016/j.jenvman.2021.112495
  » http://dx.doi.org/10.1016/j.jenvman.2021.112495
• Christiansen, G., Fastner, J., Erhard, M., Börner, T., & Dittmann, E., 2003. Microcystin biosynthesis in Planktothrix: Genes, evolution, and manipulation. J. Bacteriol. 185(2), 564-572. PMid:12511503. http://dx.doi.org/10.1128/JB.185.2.564-572.2003
  » http://dx.doi.org/10.1128/JB.185.2.564-572.2003
• Cirés, S., Wörmer, L., Ballot, A., Agha, R., Wiedner, C., Velázquez, D., Casero, M.C., & Quesada, A., 2014. Phylogeography of cylindrospermopsin and paralytic shellfish toxin-producing Nostocales cyanobacteria from Mediterranean Europe (Spain). Appl. Environ. Microbiol. 80(4), 1359-1370. PMid:24334673. http://dx.doi.org/10.1128/AEM.03002-13
  » http://dx.doi.org/10.1128/AEM.03002-13
• Corbel, S., Mougin, C., & Bouaïcha, N., 2014. Cyanobacterial toxins: modes of actions, fate in aquatic and soil ecosystems, phytotoxicity and bioaccumulation in agricultural crops. Chemosphere 96, 1-15. PMid:24012139. http://dx.doi.org/10.1016/j.chemosphere.2013.07.056
  » http://dx.doi.org/10.1016/j.chemosphere.2013.07.056
• Cuesta, F., Llambí, L.D., Huggel, C., Drenkhan, F., Gosling, W.D., Muriel, P., Jaramillo, R., & Tovar, C., 2019. New land in the Neotropics: a review of biotic community, ecosystem, and landscape transformations in the face of climate and glacier change. Reg. Environ. Change 19(6), 1623-1642. http://dx.doi.org/10.1007/s10113-019-01499-3
  » http://dx.doi.org/10.1007/s10113-019-01499-3
• de la Cruz, A.A., Hiskia, A., Kaloudis, T., Chernoff, N., Hill, D., Antoniou, M.G., He, X., Loftin, K., O’Shea, K., Zhao, C., Pelaez, M., Han, C., Lynch, T.J., & Dionysiou, D.D., 2013. A review on cylindrospermopsin: the global occurrence, detection, toxicity and degradation of a potent cyanotoxin. Environ. Sci. Process. Impacts 15(11), 1979-2003. PMid:24056894. http://dx.doi.org/10.1039/c3em00353a
  » http://dx.doi.org/10.1039/c3em00353a
• Echeverría-Almeida, J., & Athens, J.S., 2016. Investigación subacuática en las lagunas de Yahuarcocha, San Pablo, Mojanda, provincia de Imbabura, Ecuador. Rev. Arqueol. Am. 34, 125-142.
• Fan, Z.Y., Li, X.R., Mao, D.P., Zhu, G.F., Wang, S.Y., & Quan, Z.X., 2009. Could nested PCR be applicable for the study of microbial diversity? World J. Microbiol. Biotechnol. 25(8), 1447-1452. http://dx.doi.org/10.1007/s11274-009-0033-3
  » http://dx.doi.org/10.1007/s11274-009-0033-3
• Gaget, V., Humpage, A.R., Huang, Q., Monis, P., & Brookes, J.D., 2017. Benthic cyanobacteria: A source of cylindrospermopsin and microcystin in Australian drinking water reservoirs. Water Res. 124, 454-464. PMid:28787682. http://dx.doi.org/10.1016/j.watres.2017.07.073
  » http://dx.doi.org/10.1016/j.watres.2017.07.073
• Gobler, C.J., 2020. Climate Change and Harmful Algal Blooms: insights and perspective. Harmful Algae 91, 101731. PMid:32057341. http://dx.doi.org/10.1016/j.hal.2019.101731
  » http://dx.doi.org/10.1016/j.hal.2019.101731
• Gómez Durañona, G.D., 2005. Estudio de los sedimentos de la Laguna De Limoncocha (Provincia De Sucumbios-Ecuador) (Doctoral Thesis in Edaphology). Quito-Ecuador: Universidad Internacional SEK.
• Haddad, S.P., Bobbitt, J.M., Taylor, R.B., Lovin, L.M., Conkle, J.L., Chambliss, C.K., & Brooks, B.W., 2019. Determination of microcystins, nodularin, anatoxin-a, cylindrospermopsin, and saxitoxin in water and fish tissue using isotope dilution liquid chromatography tandem mass spectrometry. J. Chromatogr. A 1599, 66-74. PMid:30961962. http://dx.doi.org/10.1016/j.chroma.2019.03.066
  » http://dx.doi.org/10.1016/j.chroma.2019.03.066
• Hawkins, P.R., Runnegar, M.T., Jackson, A.R., & Falconer, I.R., 1985. Severe hepatotoxicity caused by the tropical cyanobacterium (blue-green alga) Cylindrospermopsis raciborskii (Woloszynska) Seenaya and Subba Raju isolated from a domestic water supply reservoir. Appl. Environ. Microbiol. 50(5), 1292-1295. PMid:3937492. http://dx.doi.org/10.1128/aem.50.5.1292-1295.1985
  » http://dx.doi.org/10.1128/aem.50.5.1292-1295.1985
• Hercog, K., Maisanaba, S., Filipič, M., Jos, Á., Cameán, A.M., & Žegura, B., 2017. Genotoxic potential of the binary mixture of cyanotoxins microcystin-LR and cylindrospermopsin. Chemosphere 189, 319-329. PMid:28942258. http://dx.doi.org/10.1016/j.chemosphere.2017.09.075
  » http://dx.doi.org/10.1016/j.chemosphere.2017.09.075
• Hoff-Risseti, C., Dörr, F.A., Schaker, P.D.C., Pinto, E., Werner, V.R., & Fiore, M.F., 2013. Cylindrospermopsin and Saxitoxin Synthetase Genes in Cylindrospermopsis raciborskii Strains from Brazilian Freshwater. PLoS One 8(8), e74238. PMid:24015317. http://dx.doi.org/10.1371/journal.pone.0074238
  » http://dx.doi.org/10.1371/journal.pone.0074238
• Howard, M.D.A., Nagoda, C., Kudela, R.M., Hayashi, K., Tatters, A., Caron, D.A., Busse, L., Brown, J., Sutula, M., & Stein, E.D., 2017. Microcystin prevalence throughout lentic waterbodies in coastal southern California. Toxins (Basel) 9(7), 1-21. PMid:28737685. http://dx.doi.org/10.3390/toxins9070231
  » http://dx.doi.org/10.3390/toxins9070231
• Huguet, A., Lanceleur, R., Quenault, H., Le Hégarat, L., & Fessard, V., 2019. Identification of key pathways involved in the toxic response of the cyanobacterial toxin cylindrospermopsin in human hepatic HepaRG cells. Toxicol. In Vitro 58, 69-77. PMid:30905859. http://dx.doi.org/10.1016/j.tiv.2019.03.023
  » http://dx.doi.org/10.1016/j.tiv.2019.03.023
• Kobayasi, H., & Mayama, S., 1982. Most pollution-tolerant diatoms of severly polluted rivers in the vicinity of Tokyo. Jpn. J. Physiol. 30, 188-196.
• Kokociński, M., Gagala, I., Jasser, I., Karosiene, J., Kasperovičiene, J., Kobos, J., Koreiviene, J., Soininen, J., Szczurowska, A., Woszczyk, M., & Mankiewicz-Boczek, J., 2017. Distribution of invasive Cylindrospermopsis raciborskii in the East-Central Europe is driven by climatic and local environmental variables. FEMS Microbiol. Ecol. 93(4), 1-8. PMid:28334256. http://dx.doi.org/10.1093/femsec/fix035
  » http://dx.doi.org/10.1093/femsec/fix035
• Kumar, S., Stecher, G., Li, M., Knyaz, C., & Tamura, K., 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35(6), 1547-1549. PMid:29722887. http://dx.doi.org/10.1093/molbev/msy096
  » http://dx.doi.org/10.1093/molbev/msy096
• Kurmayer, R., Christiansen, G., Fastner, J., & Börner, T., 2004. Abundance of active and inactive microcystin genotypes in populations of the toxic cyanobacterium Planktothrix spp. Environ. Microbiol. 6(8), 831-841. PMid:15250885. http://dx.doi.org/10.1111/j.1462-2920.2004.00626.x
  » http://dx.doi.org/10.1111/j.1462-2920.2004.00626.x
• Lajeunesse, A., Segura, P.A., Gélinas, M., Hudon, C., Thomas, K., Quilliam, M.A., & Gagnon, C., 2012. Detection and confirmation of saxitoxin analogues in freshwater benthic Lyngbya wollei algae collected in the St. Lawrence River (Canada) by liquid chromatography-tandem mass spectrometry. J. Chromatogr. A 1219, 93-103. PMid:22169195. http://dx.doi.org/10.1016/j.chroma.2011.10.092
  » http://dx.doi.org/10.1016/j.chroma.2011.10.092
• Lei, L., Lei, M., Lu, Y., Peng, L., & Han, B.P., 2019. Development of real-time PCR for quantification of Cylindrospermopsis raciborskii cells and potential cylindrospermopsin-producing genotypes in subtropicalreservoirs of southern China. J. Appl. Phycol. 31(6), 3749-3758. http://dx.doi.org/10.1007/s10811-019-01898-3
  » http://dx.doi.org/10.1007/s10811-019-01898-3
• Loftin, K.A., Graham, J.L., Hilborn, E.D., Lehmann, S.C., Meyer, M.T., Dietze, J.E., & Griffith, C.B., 2016. Cyanotoxins in inland lakes of the United States: Occurrence and potential recreational health risks in the EPA National Lakes Assessment 2007. Harmful Algae 56, 77-90. PMid:28073498. http://dx.doi.org/10.1016/j.hal.2016.04.001
  » http://dx.doi.org/10.1016/j.hal.2016.04.001
• Lorenzi, A.S., Cordeiro-Araújo, M.K., Chia, M.A., & Bittencourt-Oliveira, M.C., 2018. Cyanotoxin contamination of semiarid drinking water supply reservoirs. Environ. Earth Sci. 77(16), 595. http://dx.doi.org/10.1007/s12665-018-7774-y
  » http://dx.doi.org/10.1007/s12665-018-7774-y
• Mankiewicz-Boczek, J., Kokociński, M., Gagała, I., Pawełczyk, J., Jurczak, T., & Dziadek, J., 2012. Preliminary molecular identification of cylindrospermopsin-producing Cyanobacteria in two Polish lakes (Central Europe). FEMS Microbiol Lett. 326(2), 173-179. PMid:22092753. https://doi.org/10.1111/j.1574-6968.2011.02451.x
  » https://doi.org/10.1111/j.1574-6968.2011.02451.x
• Mantzouki, E., Lürling, M., Fastner, J., de Senerpont Domis, L., Wilk-Woźniak, E., Koreivienė, J., Seelen, L., Teurlincx, S., Verstijnen, Y., Krztoń, W., Walusiak, E., Karosienė, J., Kasperovičienė, J., Savadova, K., Vitonytė, I., Cillero-Castro, C., Budzyńska, A., Goldyn, R., Kozak, A., Rosińska, J., Szeląg-Wasielewska, E., Domek, P., Jakubowska-Krepska, N., Kwasizur, K., Messyasz, B., Pełechaty, A., Pełechaty, M., Kokocinski, M., García-Murcia, A., Real, M., Romans, E., Noguero-Ribes, J., Duque, D.P., Fernández-Morán, E., Karakaya, N., Häggqvist, K., Demir, N., Beklioğlu, M., Filiz, N., Levi, E.E., Iskin, U., Bezirci, G., Tavşanoğlu, Ü.N., Özhan, K., Gkelis, S., Panou, M., Fakioglu, Ö., Avagianos, C., Kaloudis, T., Çelik, K., Yilmaz, M., Marcé, R., Catalán, N., Bravo, A.G., Buck, M., Colom-Montero, W., Mustonen, K., Pierson, D., Yang, Y., Raposeiro, P.M., Gonçalves, V., Antoniou, M.G., Tsiarta, N., McCarthy, V., Perello, V.C., Feldmann, T., Laas, A., Panksep, K., Tuvikene, L., Gagala, I., Mankiewicz-Boczek, J., Yağcı, M.A., Çınar, Ş., Çapkın, K., Yağcı, A., Cesur, M., Bilgin, F., Bulut, C., Uysal, R., Obertegger, U., Boscaini, A., Flaim, G., Salmaso, N., Cerasino, L., Richardson, J., Visser, P.M., Verspagen, J.M.H., Karan, T., Soylu, E.N., Maraşlıoğlu, F., Napiórkowska-Krzebietke, A., Ochocka, A., Pasztaleniec, A., Antão-Geraldes, A.M., Vasconcelos, V., Morais, J., Vale, M., Köker, L., Akçaalan, R., Albay, M., Špoljarić Maronić, D., Stević, F., Žuna Pfeiffer, T., Fonvielle, J., Straile, D., Rothhaupt, K.O., Hansson, L.A., Urrutia-Cordero, P., Bláha, L., Geriš, R., Fránková, M., Koçer, M.A.T., Alp, M.T., Remec-Rekar, S., Elersek, T., Triantis, T., Zervou, S.K., Hiskia, A., Haande, S., Skjelbred, B., Madrecka, B., Nemova, H., Drastichova, I., Chomova, L., Edwards, C., Sevindik, T.O., Tunca, H., Önem, B., Aleksovski, B., Krstić, S., Vucelić, I.B., Nawrocka, L., Salmi, P., Machado-Vieira, D., de Oliveira, A.G., Delgado-Martín, J., García, D., Cereijo, J.L., Gomà, J., Trapote, M.C., Vegas-Vilarrúbia, T., Obrador, B., Grabowska, M., Karpowicz, M., Chmura, D., Úbeda, B., Gálvez, J.Á., Özen, A., Christoffersen, K.S., Warming, T.P., Kobos, J., Mazur-Marzec, H., Pérez-Martínez, C., Ramos-Rodríguez, E., Arvola, L., Alcaraz-Párraga, P., Toporowska, M., Pawlik-Skowronska, B., Niedźwiecki, M., Pęczuła, W., Leira, M., Hernández, A., Moreno-Ostos, E., Blanco, J.M., Rodríguez, V., Montes-Pérez, J.J., Palomino, R.L., Rodríguez-Pérez, E., Carballeira, R., Camacho, A., Picazo, A., Rochera, C., Santamans, A.C., Ferriol, C., Romo, S., Soria, J.M., Dunalska, J., Sieńska, J., Szymański, D., Kruk, M., Kostrzewska-Szlakowska, I., Jasser, I., Žutinić, P., Gligora Udovič, M., Plenković-Moraj, A., Frąk, M., Bańkowska-Sobczak, A., Wasilewicz, M., Özkan, K., Maliaka, V., Kangro, K., Grossart, H.P., Paerl, H.W., Carey, C.C., & Ibelings, B.W., 2018. Temperature effects explain continental scale distribution of cyanobacterial toxins. Toxins (Basel) 10(4), 1-24. PMid:29652856. http://dx.doi.org/10.3390/toxins10040156
  » http://dx.doi.org/10.3390/toxins10040156
• Massey, I.Y., & Yang, F., 2020. A Mini Review on Microcystins and Bacterial Degradation. Toxins (Basel) 12(4), 268. PMid:32326338. http://dx.doi.org/10.3390/toxins12040268
  » http://dx.doi.org/10.3390/toxins12040268
• McGinnis, S., & Madden, T. L., 2004. BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 32, 0305-1048. https://doi.org/10.1093/nar/gkh435
  » https://doi.org/10.1093/nar/gkh435
• Meriluoto, J., Blaha, L., Bojadzija, G., Bormans, M., Brient, L., Codd, G.A., Drobac, D., Faassen, E.J., Fastner, J., Hiskia, A., Ibelings, B.W., Kaloudis, T., Kokocinski, M., Kurmayer, R., Pantelić, D., Quesada, A., Salmaso, N., Tokodi, N., Triantis, T.M., Visser, P.M., & Svirčev, Z.., 2017. Toxic cyanobacteria and cyanotoxins in European waters - recent progress achieved through the CYANOCOST action and challenges for further research. AIOL J. 8(1), 161-178. http://dx.doi.org/10.4081/aiol.2017.6429
  » http://dx.doi.org/10.4081/aiol.2017.6429
• Metcalf, J.S., Banack, S.A., Powell, J.T., Tymm, F.J.M., Murch, S.J., Brand, L.E., & Cox, P.A., 2018. Public health responses to toxic cyanobacterial blooms: perspectives from the 2016 Florida event. Water Policy 20(5), 919-932. http://dx.doi.org/10.2166/wp.2018.012
  » http://dx.doi.org/10.2166/wp.2018.012
• Mihali, T.K., Kellmann, R., Muenchhoff, J., Barrow, K.D., & Neilan, B.A., 2008. Characterization of the gene cluster responsible for cylindrospermopsin biosynthesis. Appl. Environ. Microbiol. 74(3), 716-722. PMid:18065631. http://dx.doi.org/10.1128/AEM.01988-07
  » http://dx.doi.org/10.1128/AEM.01988-07
• Mikalsen, B., Boison, G., Skulberg, O.M., Fastner, J., Davies, W., Gabrielsen, T.M., Rudi, K., & Jakobsen, K.S., 2003. Natural variation in the microcystin synthetase operon mcyABC and impact on microcystin production in Microcystis strains. J. Bacteriol. 185(9), 2774-2785. PMid:12700256. http://dx.doi.org/10.1128/JB.185.9.2774-2785.2003
  » http://dx.doi.org/10.1128/JB.185.9.2774-2785.2003
• Milutinović, A., Sedmak, B., Horvat-Znidarsic, I., & Suput, D., 2002. Renal injuries induced by chronic intoxication with microcystins. Cell. Mol. Biol. Lett. 7(1), 139-141. PMid:11944069.
• Mohamed, Z.A., El-Sharouny, H.M., & Ali, W.S.M., 2006. Microcystin production in benthic mats of cyanobacteria in the Nile River and irrigation canals, Egypt. Toxicon 47(5), 584-590. PMid:16564062. http://dx.doi.org/10.1016/j.toxicon.2006.01.029
  » http://dx.doi.org/10.1016/j.toxicon.2006.01.029
• Mowe, M.A.D., Mitrovic, S.M., Lim, R.P., Furey, A., & Yeo, D.C.J., 2015. Tropical cyanobacterial blooms: a review of prevalence, problem taxa, toxins and influencing environmental factors. J. Limnol. 74(2), 205-224. http://dx.doi.org/10.4081/jlimnol.2014.1005
  » http://dx.doi.org/10.4081/jlimnol.2014.1005
• Nishizawa, T., Ueda, A., Asayama, M., Fujii, K., Harada, K., Ochi, K., & Shirai, M., 2000. Polyketide synthase gene coupled to the peptide synthetase module involved in the biosynthesis of the cyclic heptapeptide microcystin. J Biochem 127(5), 779-789. PMid:10788786. http://dx.doi.org/10.1093/oxfordjournals.jbchem.a022670
  » http://dx.doi.org/10.1093/oxfordjournals.jbchem.a022670
• Nübel, U., Garcia-Pichel, F., & Muyzer, G., 1997. PCR primers to amplify 16S rRNA genes from cyanobacteria. Appl. Environ. Microbiol. 63(8), 3327-3332. PMid:9251225. http://dx.doi.org/10.1128/aem.63.8.3327-3332.1997
  » http://dx.doi.org/10.1128/aem.63.8.3327-3332.1997
• Ohtani, I., Moore, R.E., & Runnegar, M.T.C., 1992. Cylindrospermopsin: a potent hepatotoxin from the blue-green alga Cylindrospermopsis raciborskii J. Am. Chem. Soc. 114(20), 7941-7942. http://dx.doi.org/10.1021/ja00046a067
  » http://dx.doi.org/10.1021/ja00046a067
• Orquera, E., & Cabrera, M., 2020. Caracterización del estado trófico de la laguna de Yambo mediante el análisis de fósforo. InfoANALITICA 8(1), 99-111. http://dx.doi.org/10.26807/ia.v8i1.119
  » http://dx.doi.org/10.26807/ia.v8i1.119
• Padisák, J., & Reynolds, C.S., 1998. Selection of phytoplankton associations in Lake Balaton, Hungary, in response to eutrophication and restoration measures, with special reference to the cyanoprokaryotes. Hydrobiologia 384(1-3), 41-53. http://dx.doi.org/10.1023/A:1003255529403
  » http://dx.doi.org/10.1023/A:1003255529403
• Padisák, J., 1997. Cylindrospermopsis raciborskii (Woloszynska) Seenayya et Subba Raju, an expanding, highly adaptive cyanobacterium: worldwide distribution and review of its ecology. Archiv fur Hydrobiologie, 107, 563-593.
• Percival, S.L., & Williams, D.W., 2013. Cyanobacteria. In: Percival, S.L., Yates, M.V., Williams, D., Chalmers, R., Gray, N. (Eds.), Microbiology of waterborne diseases: microbiological aspects and risks (2nd ed.). Cambridge: Academic Press. https://doi.org/10.1016/B978-0-12-415846-7.00005-6
  » https://doi.org/10.1016/B978-0-12-415846-7.00005-6
• Rasmussen, B., Fletcher, I.R., Brocks, J.J., & Kilburn, M.R., 2008. Reassessing the first appearance of eukaryotes and cyanobacteria. Nature 455(7216), 1101-1104. PMid:18948954. http://dx.doi.org/10.1038/nature07381
  » http://dx.doi.org/10.1038/nature07381
• Ríos-Touma, B., Villamarín, C., Jijón, G., Checa, J., Granda-Albuja, G., Bonifaz, E., & Guerrero-Latorre, L., 2022. Aquatic biodiversity loss in Andean urban streams. Urban Ecosyst. http://dx.doi.org/10.1007/s11252-022-01248-1
  » http://dx.doi.org/10.1007/s11252-022-01248-1
• Rodríguez Ayala, S., Flores, R., Rodríguez, M., & Andocilla, M., 2018. Quantitative determination of heavy metal hyperaccumulation in a macrophyte sample of Schoenoplectus californicus from Lago San Pablo, Imbabura-Ecuador. Ciencia 19(4), http://dx.doi.org/10.24133/ciencia.v19i4.545
  » http://dx.doi.org/10.24133/ciencia.v19i4.545
• Schembri, M.A., Neilan, B.A., & Saint, C.P., 2001. Identification of genes implicated in toxin production in the cyanobacterium Cylindrospermosis raciborskii Environ. Toxicol. 16(5), 413-421. PMid:11594028. http://dx.doi.org/10.1002/tox.1051
  » http://dx.doi.org/10.1002/tox.1051
• Schutz, L., 2014. Survey of agricultural practices and alternatives to pesticide use to conserve water resources in the Mojanda Watershed, Ecuador. Future Food J. Food Agric. Soc. 2(1), 76-92.
• Seawright, A.A., Nolan, C.C., Shaw, G.R., Chiswell, R.K., Norris, R.L., Moore, M.R., & Smith, M.J., 1999. The oral toxicity for mice of the tropical cyanobacterium Cylindrospermopsis raciborskii (Woloszynska). Environ. Toxicol. 14(1), 135-142. http://dx.doi.org/10.1002/(SICI)1522-7278(199902)14:1<135::AID-TOX17>3.0.CO;2-L
  » http://dx.doi.org/10.1002/(SICI)1522-7278(199902)14:1<135::AID-TOX17>3.0.CO;2-L
• Seymour, M., 2019. Rapid progression and future of environmental DNA research. Commun. Biol. 2(1), 80. PMid:30820475. http://dx.doi.org/10.1038/s42003-019-0330-9
  » http://dx.doi.org/10.1038/s42003-019-0330-9
• Shalev-Alon, G., Sukenik, A., Livnah, O., Schwarz, R., & Kaplan, A., 2002. A novel gene encoding amidinotransferase in the cylindrospermopsin producing cyanobacterium Aphanizomenon ovalisporum FEMS Microbiol. Lett. 209(1), 87-91. PMid:12007659. http://dx.doi.org/10.1111/j.1574-6968.2002.tb11114.x
  » http://dx.doi.org/10.1111/j.1574-6968.2002.tb11114.x
• Smith, F.M.J., Wood, S.A., van Ginkel, R., Broady, P.A., & Gaw, S., 2011. First report of saxitoxin production by a species of the freshwater benthic cyanobacterium, Scytonema agardh Toxicon 57(4), 566-573. PMid:21223973. http://dx.doi.org/10.1016/j.toxicon.2010.12.020
  » http://dx.doi.org/10.1016/j.toxicon.2010.12.020
• Stefanova, K., Radkova, M., Uzunov, B., Gärtner, G., & Stoyneva-Gärtner, M., 2020. Pilot search for cylindrospermopsin-producers in nine shallow Bulgarian waterbodies reveals nontoxic strains of Raphidiopsis raciborskii, R. mediterranea and Chrysosporum bergii. Biotechnol. Biotechnol. Equip. 34(1), 384-394. http://dx.doi.org/10.1080/13102818.2020.1758595
  » http://dx.doi.org/10.1080/13102818.2020.1758595
• Štraser, A., Filipič, M., Gorenc, I., & Žegura, B., 2013. The influence of cylindrospermopsin on oxidative DNA damage and apoptosis induction in HepG2 cells. Chemosphere 92(1), 24-30. PMid:23601126. http://dx.doi.org/10.1016/j.chemosphere.2013.03.023
  » http://dx.doi.org/10.1016/j.chemosphere.2013.03.023
• Stüken, A., Rücker, J., Endrulat, T., Preussel, K., Hemm, M., Nixdorf, B., Karsten, U., & Wiedner, C., 2006. Distribution of three alien cyanobacterial species (Nostocales) in northeast Germany: Cylindrospermopsis raciborskii, Anabaena bergii and Aphanizomenon aphanizomenoides. Phycologia 45(6), 696-703. http://dx.doi.org/10.2216/05-58.1
  » http://dx.doi.org/10.2216/05-58.1
• Thomas, B., & Dittmann, E., 2005. Molecular biology of cyanobacterial toxins: genetic basis of microsystin production. In J. Huisman, H.C.P. Matthisj, P.M. Visser, eds. Harmful cyanobacteria. USA: Springer, 25-40.
• Van Colen, W., Portilla, K., Oña, T., Wyseure, G., Goethals, P., Velarde, E., & Muylaert, K., 2017. Limnology of the neotropical high elevation shallow lake Yahuarcocha (Ecuador) and challenges for managing eutrophication using biomanipulation. Limnologica 67, 37-44. http://dx.doi.org/10.1016/j.limno.2017.07.008
  » http://dx.doi.org/10.1016/j.limno.2017.07.008
• Venegas, J., Castillejo Pons, P., Chamorro, S., Carrillo, I., & Lobo, E., 2018. Characterization and spatio-temporal dynamics of Cylindrospermopsis raciborski in an Amazonian Lagoon, Ecuador. Enfoque UTE 9(2), 117-124. http://dx.doi.org/10.29019/enfoqueute.v9n2.195
  » http://dx.doi.org/10.29019/enfoqueute.v9n2.195
• Via-Ordorika, L., Fastner, J., Kurmayer, R., Hisbergues, M., Dittmann, E., Komarek, J., Erhard, M., & Chorus, I., 2004. Distribution of microcystin-producing and non-microcystin-producing Microcystis sp. in European freshwater bodies: detection of microcystins and microcystin genes in individual colonies. Syst. Appl. Microbiol. 27(5), 592-602. PMid:15490561. http://dx.doi.org/10.1078/0723202041748163
  » http://dx.doi.org/10.1078/0723202041748163
• Walter, J.M., Lopes, F.A.C., Lopes-Ferreira, M., Vidal, L.M., Leomil, L., Melo, F., de Azevedo, G.S., Oliveira, R.M.S., Medeiros, A.J., Melo, A.S.O., De Rezende, C.E., Tanuri, A., & Thompson, F.L., 2018. Occurrence of harmful cyanobacteria in drinking water from a severely drought-impacted semi-arid region. Front. Microbiol. 9, 176. PMid:29541063. http://dx.doi.org/10.3389/fmicb.2018.00176
  » http://dx.doi.org/10.3389/fmicb.2018.00176
• Whitton, B.A., & Potts, M., 2002. Introduction the Cyanobacteria. Bogotá. Kluwer Academic Publishers. http://dx.doi.org/10.1007/0-306-46855-7_1
  » http://dx.doi.org/10.1007/0-306-46855-7_1
• Wiedner, C., Rücker, J., Fastner, J., Chorus, I., & Nixdorf, B., 2008. Seasonal dynamics of cylindrospermopsin and cyanobacteria in two German lakes. Toxicon 52(6), 677-686. PMid:18725243. http://dx.doi.org/10.1016/j.toxicon.2008.07.017
  » http://dx.doi.org/10.1016/j.toxicon.2008.07.017
• Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., & Madden, T.L., 2012. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13(1), 134. PMid:22708584. http://dx.doi.org/10.1186/1471-2105-13-134
  » http://dx.doi.org/10.1186/1471-2105-13-134
• Zhang, W., Lou, I., Ung, W.K., Kong, Y., & Mok, K.M., 2014. Application of PCR and real-time PCR for monitoring cyanobacteria, Microcystis spp. and Cylindrospermopsis raciborskii in Macau freshwater reservoir. Front. Earth Sci. 8(2), 291-301. http://dx.doi.org/10.1007/s11707-013-0409-4
  » http://dx.doi.org/10.1007/s11707-013-0409-4
• Zhou, L., Yu, H., & Chen, K., 2002. Relationship between microcystin in drinking water and colorectal cancer. Biomed Environ Sci. 15(2), 166-171. PMid:12244757.
• Zupančič, M., Kogovšek, P., Šter, T., Remec Rekar, Š., Cerasino, L., Baebler, Š., Krivograd Klemenčič, A., & Eleršek, T., 2021. Potentially toxic planktic and benthic cyanobacteria in slovenian freshwater bodies: detection by quantitative PCR. Toxins (Basel) 13(2), 1-19. PMid:33670338. http://dx.doi.org/10.3390/toxins13020133
  » http://dx.doi.org/10.3390/toxins13020133

Edited by

Associate Editor: Fabiana Schneck

Publication Dates

• Publication in this collection
  14 Oct 2022
• Date of issue
  2022

History

• Received
  09 Mar 2022
• Accepted
  28 Sept 2022